Biochemistry
9th Edition
ISBN: 9781319114671
Author: Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.
Publisher: W. H. Freeman
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 32, Problem 6P
Interpretation Introduction
Interpretation:
The reason for the occurrence of 20 bp inverted repeats in a DNA sequence should be determined.
Concept introduction:
The single-stranded sequence which is followed by its complement in the reverse downstream direction, is termed as an inverted repeat. The sequences between the initial sequence and the reverse complement can be of any length.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Using Fig. as a guide, draw the complete structure of a nucleoside triphosphate before and after it becomes incorporated into a polynucleotide chain. Draw the structure that would result if the newly formed phosphodiester bond were hydrolyzed.
An extra piece. In one type of mutation leading to a form of
thalassemia, the mutation of a single base (G to A) generates a new 3'
3' splice site (blue in the illustration below) akin to the normal one
(yellow) but farther upstream.
Normal 3' end
of intron
5' CCTATTGGTCTATTITCCACCCITAGGCTGCTG 3'
5' CCTATTAGTCTAIIIICCACCCTTAGGCTGCTG 3'
What is the amino acid sequence of the extra segment of protein
synthesized in a thalassemic patient having a mutation leading to
aberrant splicing? The reading frame after the splice site begins with
TCT.
How many sites? A researcher has isolated a restriction endonuclease that cleaves at only one particular 10-base-pair site. Would this enzyme be useful in protecting cells from viral infections, given that a typical viral genome is 50,000 base pairs long? Explain
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- Question 8 Review translation. Match the term and its description. Each term can only be used once. This site holds the tRNA that carries the growing polypeptide chain | Choose ) This site holds the tRNA that carries the next amino acid to be | Choose J added to the chain This site is the exit site, where discharged tRNAS leave the [ Choose ) ribosome Initiation, elongation and termination | Choose J >arrow_forward. Pancreatic deoxyribonuclease I (DNase I) is a nuclease that makes single-strand nicks on double-stranded DNA. It has been observed that treatment of nucleosomal core particles with DNase I yields a peculiar result. When DNA from such a digestion is electrophoresed under denaturing conditions, the single-stranded fragments are observed to occur in a regular periodicity of about 10 bases. Suggest an explanation of this result in terms of the structure of the nucleo- some.arrow_forwardAAAGAGAAAAGAAUA to AAAGAGAAAUGAAUA. Suppose the codon sequence has a single base pair mutation If the old protein sequence was Lys-Glu-Lys-Arg-Ile, what will be the new sequence encoded by the mutant gene? (Use the 3-letter amino acid abbreviations with hyphens and no spaces in between, i.e. Ser-Asn-Tyr-Leu-Pro.) Submit Answer Retry Entire Group No more group attempts remainarrow_forward
- Read it carefully.. Draw only correct diagrams.. In the Watson-Crick DNA base pairing model, Adenine (A) binds to thymine (T), guanine (G) binds to cytosine (C). 1. Draw the structures of thymine and adenine stabilized by Watson-Crick base pair interaction. 2. Also draw the structure of the amide group of glutamine in an interaction of this T-A pair in a way that maximally satisfies the hydrogen bonding capacity of amide.arrow_forward. Give two reasons to explain why a proline residue in the middle of an ahelix is predicted to be destabilizing to the helical structurearrow_forwardPolymerase inhibition. Cordycepin inhibits poly(A) synthesis at low concentrations and RNA synthesis at higher concentrations. NH2 H. он Cordycepin (3'-deoxyadenosine) a. What is the basis of inhibition by cordycepin? b. Why is poly(A) synthesis more sensitive than the synthesis of other RNAS to the presence of cordycepin? c. Does cordycepin need to be modified to exert its effect?arrow_forward
- Leaderless. The MRNA for the A repressor begins with 5'-AUG-3', 5'-AUG-3', which encodes the methionine residue that begins the protein. What is unusual about this beginning? Would it cause the MRNA to translate efficiently or not?arrow_forwardPlease help me with this question. How many amino acid residues are in the heavy and light chains of the Fab fragment, and how many amino acid residues are in lysozyme?arrow_forwardOriginal sequence: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ Question: 4) In a mutant you discovered that the underlined nucleotide has been deleted. What would the resulting peptide sequence be? What type of mutation is this? 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3arrow_forward
- This is DNA. Locate the nitrogen bases (nitrogens are blue). Where are they located in the molecule?Locate the sugars and phosphates, and describe their location. Adjacent nucleotides are linked by covalent phosphodiester bonds (-O-P-O-) produced by a condensation reaction. What parts of the adjacent nucleotides are linked by phosphodiester bonds?Two nitrogenous bases extending towards the middle of the double helix. Are there any covalent bonds between these bases?If there are no covalent bonds between these bases, what other kinds of bonds might hold the two strands of the double helix together?arrow_forward. Some naturally occurring polynucleotide sequences are palindromic; that is, they are self-complementary about an axis of symmetry. Such a sequence is TCAAGTCCATGGACTTGG AGTTCAGGTACCTGAACC Show how this structure might form a double hairpin, or cruciform, conformation. Indicate the center of symmetry in the sequence and the bounds of the cruciform.arrow_forwardAlpha polypeptide (ADH1A). Give a detailed description of its role in the disease. Describe the impact of the disease on society.Describe a way in which your gene can be manipulated to treat the disease. Assume you can make any changes to the protein product and describe specifically how it will affect its interaction with other molecules.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Macromolecules | Classes and Functions; Author: 2 Minute Classroom;https://www.youtube.com/watch?v=V5hhrDFo8Vk;License: Standard youtube license