(a) Interpretation: Nucleolus of 3 different tissue that is brain, liver and muscle are collected and allowed to undergo transcription. The RNA was applied to DNA chips. The cause of intensity of hybridization differing from gene to gene is to be described. Concept introduction: DNA chip technology is also known as the DNA microarray technology. In this process different genes or piece of DNA are collected in a microarray. These genes are attached to a solid surface. When the sample of polynucleotide strand is added upon it, due to complementary nature of nucleotides specific polynucleotide strand it will attach to its complementary strands only. The intensity of shading helps in identifying which polynucleotide stands were there in the sample.

Question

Want to see the full answer?

Answer 1

Question

Chapter 30, Problem 23P

Interpretation Introduction

(a)

Interpretation:

Nucleolus of 3 different tissue that is brain, liver and muscle are collected and allowed to undergo transcription. The RNA was applied to DNA chips. The cause of intensity of hybridization differing from gene to gene is to be described.

Concept introduction:

DNA chip technology is also known as the DNA microarray technology. In this process different genes or piece of DNA are collected in a microarray. These genes are attached to a solid surface. When the sample of polynucleotide strand is added upon it, due to complementary nature of nucleotides specific polynucleotide strand it will attach to its complementary strands only. The intensity of shading helps in identifying which polynucleotide stands were there in the sample.

Interpretation Introduction

(b)

Interpretation:

The cause of different hybridization pattern of same RNA in different tissue is to be described.

Concept introduction:

DNA chip technology is also known as the DNA microarray technology. In this process different genes or piece of DNA are collected in a microarray. These genes are attached to a solid surface. When the sample of polynucleotide strand is added upon it, due to complementary nature of nucleotides specific polynucleotide strand will attach to its complementary strands only. And the intensity of shading helps in identifying which polynucleotide stands were there in the sample.

Interpretation Introduction

(c)

Interpretation:

The cause of expression of some genes in all the tissues are to be described.

Concept introduction:

DNA chip technology is also known as the DNA microarray technology. In this process different genes or piece of DNA are collected in a microarray. These genes are attached to a solid surface. When the sample of polynucleotide strand is added upon it due to complementary nature of nucleotides specific polynucleotide strand will attach to its complementary strands only. And the intensity of shading helps in identifying which polynucleotide stands were there in the sample.

Interpretation Introduction

(d)

Interpretation:

Cause of addition of inhibition inhibitor in sample is to be proposed.

Concept introduction:

DNA chip technology is also known as the DNA microarray technology. In this process different genes or piece of DNA are collected in a microarray. These genes are attached to a solid surface. When the sample of polynucleotide strand is added upon it due to complementary nature of nucleotides specific polynucleotide strand will attach to its complementary strands only. And the intensity of shading helps in identifying which polynucleotide stands were there in the sample.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Students have asked these similar questions

Question. What would the forward primer sequence look like if it were intended to bind the area of the DNA template?

Original sequence: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ Question: 4) In a mutant you discovered that the underlined nucleotide has been deleted. What would the resulting peptide sequence be? What type of mutation is this? 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3

Instruction - Please answer them correctly - Please answer all of them, they are connected. MUTATION Fill in the correct nucleotide base pairing and amino acid sequence of the mutated DNA a. What is the 3’-5’ DNA sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) b. What is the mRNA sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) c. What is the tRNA sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) d. What is the amino acid sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) e. What is the most convincing type of mutation had occurred? (Frameshift resulting Missense; Frameshift resulting Nonsense; Substitution – Silent; Substitution – Missense; Substitution – Nonsense)

Answer 2

Question

Chapter 30, Problem 23P

Interpretation Introduction

(a)

Interpretation:

Nucleolus of 3 different tissue that is brain, liver and muscle are collected and allowed to undergo transcription. The RNA was applied to DNA chips. The cause of intensity of hybridization differing from gene to gene is to be described.

Concept introduction:

DNA chip technology is also known as the DNA microarray technology. In this process different genes or piece of DNA are collected in a microarray. These genes are attached to a solid surface. When the sample of polynucleotide strand is added upon it, due to complementary nature of nucleotides specific polynucleotide strand it will attach to its complementary strands only. The intensity of shading helps in identifying which polynucleotide stands were there in the sample.

Interpretation Introduction

(b)

Interpretation:

The cause of different hybridization pattern of same RNA in different tissue is to be described.

Concept introduction:

DNA chip technology is also known as the DNA microarray technology. In this process different genes or piece of DNA are collected in a microarray. These genes are attached to a solid surface. When the sample of polynucleotide strand is added upon it, due to complementary nature of nucleotides specific polynucleotide strand will attach to its complementary strands only. And the intensity of shading helps in identifying which polynucleotide stands were there in the sample.

Interpretation Introduction

(c)

Interpretation:

The cause of expression of some genes in all the tissues are to be described.

Concept introduction:

DNA chip technology is also known as the DNA microarray technology. In this process different genes or piece of DNA are collected in a microarray. These genes are attached to a solid surface. When the sample of polynucleotide strand is added upon it due to complementary nature of nucleotides specific polynucleotide strand will attach to its complementary strands only. And the intensity of shading helps in identifying which polynucleotide stands were there in the sample.

Interpretation Introduction

(d)

Interpretation:

Cause of addition of inhibition inhibitor in sample is to be proposed.

Concept introduction:

DNA chip technology is also known as the DNA microarray technology. In this process different genes or piece of DNA are collected in a microarray. These genes are attached to a solid surface. When the sample of polynucleotide strand is added upon it due to complementary nature of nucleotides specific polynucleotide strand will attach to its complementary strands only. And the intensity of shading helps in identifying which polynucleotide stands were there in the sample.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 3

Question

Chapter 30, Problem 23P

Interpretation Introduction

(a)

Interpretation:

Nucleolus of 3 different tissue that is brain, liver and muscle are collected and allowed to undergo transcription. The RNA was applied to DNA chips. The cause of intensity of hybridization differing from gene to gene is to be described.

Concept introduction:

DNA chip technology is also known as the DNA microarray technology. In this process different genes or piece of DNA are collected in a microarray. These genes are attached to a solid surface. When the sample of polynucleotide strand is added upon it, due to complementary nature of nucleotides specific polynucleotide strand it will attach to its complementary strands only. The intensity of shading helps in identifying which polynucleotide stands were there in the sample.

Interpretation Introduction

(b)

Interpretation:

The cause of different hybridization pattern of same RNA in different tissue is to be described.

Concept introduction:

DNA chip technology is also known as the DNA microarray technology. In this process different genes or piece of DNA are collected in a microarray. These genes are attached to a solid surface. When the sample of polynucleotide strand is added upon it, due to complementary nature of nucleotides specific polynucleotide strand will attach to its complementary strands only. And the intensity of shading helps in identifying which polynucleotide stands were there in the sample.

Interpretation Introduction

(c)

Interpretation:

The cause of expression of some genes in all the tissues are to be described.

Concept introduction:

DNA chip technology is also known as the DNA microarray technology. In this process different genes or piece of DNA are collected in a microarray. These genes are attached to a solid surface. When the sample of polynucleotide strand is added upon it due to complementary nature of nucleotides specific polynucleotide strand will attach to its complementary strands only. And the intensity of shading helps in identifying which polynucleotide stands were there in the sample.

Interpretation Introduction

(d)

Interpretation:

Cause of addition of inhibition inhibitor in sample is to be proposed.

Concept introduction:

DNA chip technology is also known as the DNA microarray technology. In this process different genes or piece of DNA are collected in a microarray. These genes are attached to a solid surface. When the sample of polynucleotide strand is added upon it due to complementary nature of nucleotides specific polynucleotide strand will attach to its complementary strands only. And the intensity of shading helps in identifying which polynucleotide stands were there in the sample.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 4

Question

Chapter 30, Problem 23P

Interpretation Introduction

(a)

Interpretation:

Nucleolus of 3 different tissue that is brain, liver and muscle are collected and allowed to undergo transcription. The RNA was applied to DNA chips. The cause of intensity of hybridization differing from gene to gene is to be described.

Concept introduction:

DNA chip technology is also known as the DNA microarray technology. In this process different genes or piece of DNA are collected in a microarray. These genes are attached to a solid surface. When the sample of polynucleotide strand is added upon it, due to complementary nature of nucleotides specific polynucleotide strand it will attach to its complementary strands only. The intensity of shading helps in identifying which polynucleotide stands were there in the sample.

Interpretation Introduction

(b)

Interpretation:

The cause of different hybridization pattern of same RNA in different tissue is to be described.

Concept introduction:

DNA chip technology is also known as the DNA microarray technology. In this process different genes or piece of DNA are collected in a microarray. These genes are attached to a solid surface. When the sample of polynucleotide strand is added upon it, due to complementary nature of nucleotides specific polynucleotide strand will attach to its complementary strands only. And the intensity of shading helps in identifying which polynucleotide stands were there in the sample.

Interpretation Introduction

(c)

Interpretation:

The cause of expression of some genes in all the tissues are to be described.

Concept introduction:

DNA chip technology is also known as the DNA microarray technology. In this process different genes or piece of DNA are collected in a microarray. These genes are attached to a solid surface. When the sample of polynucleotide strand is added upon it due to complementary nature of nucleotides specific polynucleotide strand will attach to its complementary strands only. And the intensity of shading helps in identifying which polynucleotide stands were there in the sample.

Interpretation Introduction

(d)

Interpretation:

Cause of addition of inhibition inhibitor in sample is to be proposed.

Concept introduction:

DNA chip technology is also known as the DNA microarray technology. In this process different genes or piece of DNA are collected in a microarray. These genes are attached to a solid surface. When the sample of polynucleotide strand is added upon it due to complementary nature of nucleotides specific polynucleotide strand will attach to its complementary strands only. And the intensity of shading helps in identifying which polynucleotide stands were there in the sample.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 5

Chapter 30, Problem 23P

Interpretation Introduction

(a)

Interpretation:

Nucleolus of 3 different tissue that is brain, liver and muscle are collected and allowed to undergo transcription. The RNA was applied to DNA chips. The cause of intensity of hybridization differing from gene to gene is to be described.

Concept introduction:

DNA chip technology is also known as the DNA microarray technology. In this process different genes or piece of DNA are collected in a microarray. These genes are attached to a solid surface. When the sample of polynucleotide strand is added upon it, due to complementary nature of nucleotides specific polynucleotide strand it will attach to its complementary strands only. The intensity of shading helps in identifying which polynucleotide stands were there in the sample.

Interpretation Introduction

(b)

Interpretation:

The cause of different hybridization pattern of same RNA in different tissue is to be described.

Concept introduction:

DNA chip technology is also known as the DNA microarray technology. In this process different genes or piece of DNA are collected in a microarray. These genes are attached to a solid surface. When the sample of polynucleotide strand is added upon it, due to complementary nature of nucleotides specific polynucleotide strand will attach to its complementary strands only. And the intensity of shading helps in identifying which polynucleotide stands were there in the sample.

Interpretation Introduction

(c)

Interpretation:

The cause of expression of some genes in all the tissues are to be described.

Concept introduction:

DNA chip technology is also known as the DNA microarray technology. In this process different genes or piece of DNA are collected in a microarray. These genes are attached to a solid surface. When the sample of polynucleotide strand is added upon it due to complementary nature of nucleotides specific polynucleotide strand will attach to its complementary strands only. And the intensity of shading helps in identifying which polynucleotide stands were there in the sample.

Interpretation Introduction

(d)

Interpretation:

Cause of addition of inhibition inhibitor in sample is to be proposed.

Concept introduction:

DNA chip technology is also known as the DNA microarray technology. In this process different genes or piece of DNA are collected in a microarray. These genes are attached to a solid surface. When the sample of polynucleotide strand is added upon it due to complementary nature of nucleotides specific polynucleotide strand will attach to its complementary strands only. And the intensity of shading helps in identifying which polynucleotide stands were there in the sample.

Answer 6

Chapter 30, Problem 23P

Interpretation Introduction

(a)

Interpretation:

Nucleolus of 3 different tissue that is brain, liver and muscle are collected and allowed to undergo transcription. The RNA was applied to DNA chips. The cause of intensity of hybridization differing from gene to gene is to be described.

Concept introduction:

DNA chip technology is also known as the DNA microarray technology. In this process different genes or piece of DNA are collected in a microarray. These genes are attached to a solid surface. When the sample of polynucleotide strand is added upon it, due to complementary nature of nucleotides specific polynucleotide strand it will attach to its complementary strands only. The intensity of shading helps in identifying which polynucleotide stands were there in the sample.

Answer 7

Chapter 30, Problem 23P

Interpretation Introduction

(a)

Interpretation:

Nucleolus of 3 different tissue that is brain, liver and muscle are collected and allowed to undergo transcription. The RNA was applied to DNA chips. The cause of intensity of hybridization differing from gene to gene is to be described.

Concept introduction:

DNA chip technology is also known as the DNA microarray technology. In this process different genes or piece of DNA are collected in a microarray. These genes are attached to a solid surface. When the sample of polynucleotide strand is added upon it, due to complementary nature of nucleotides specific polynucleotide strand it will attach to its complementary strands only. The intensity of shading helps in identifying which polynucleotide stands were there in the sample.

Answer 8

Interpretation Introduction

(b)

Interpretation:

The cause of different hybridization pattern of same RNA in different tissue is to be described.

Concept introduction:

DNA chip technology is also known as the DNA microarray technology. In this process different genes or piece of DNA are collected in a microarray. These genes are attached to a solid surface. When the sample of polynucleotide strand is added upon it, due to complementary nature of nucleotides specific polynucleotide strand will attach to its complementary strands only. And the intensity of shading helps in identifying which polynucleotide stands were there in the sample.

Answer 9

Interpretation Introduction

(b)

Interpretation:

The cause of different hybridization pattern of same RNA in different tissue is to be described.

Concept introduction:

DNA chip technology is also known as the DNA microarray technology. In this process different genes or piece of DNA are collected in a microarray. These genes are attached to a solid surface. When the sample of polynucleotide strand is added upon it, due to complementary nature of nucleotides specific polynucleotide strand will attach to its complementary strands only. And the intensity of shading helps in identifying which polynucleotide stands were there in the sample.

Answer 10

Interpretation Introduction

(c)

Interpretation:

The cause of expression of some genes in all the tissues are to be described.

Concept introduction:

DNA chip technology is also known as the DNA microarray technology. In this process different genes or piece of DNA are collected in a microarray. These genes are attached to a solid surface. When the sample of polynucleotide strand is added upon it due to complementary nature of nucleotides specific polynucleotide strand will attach to its complementary strands only. And the intensity of shading helps in identifying which polynucleotide stands were there in the sample.

Answer 11

Interpretation Introduction

(c)

Interpretation:

The cause of expression of some genes in all the tissues are to be described.

Concept introduction:

DNA chip technology is also known as the DNA microarray technology. In this process different genes or piece of DNA are collected in a microarray. These genes are attached to a solid surface. When the sample of polynucleotide strand is added upon it due to complementary nature of nucleotides specific polynucleotide strand will attach to its complementary strands only. And the intensity of shading helps in identifying which polynucleotide stands were there in the sample.

Answer 12

Interpretation Introduction

(d)

Interpretation:

Cause of addition of inhibition inhibitor in sample is to be proposed.

Concept introduction:

DNA chip technology is also known as the DNA microarray technology. In this process different genes or piece of DNA are collected in a microarray. These genes are attached to a solid surface. When the sample of polynucleotide strand is added upon it due to complementary nature of nucleotides specific polynucleotide strand will attach to its complementary strands only. And the intensity of shading helps in identifying which polynucleotide stands were there in the sample.

Answer 13

Interpretation Introduction

(d)

Interpretation:

Cause of addition of inhibition inhibitor in sample is to be proposed.

Concept introduction:

DNA chip technology is also known as the DNA microarray technology. In this process different genes or piece of DNA are collected in a microarray. These genes are attached to a solid surface. When the sample of polynucleotide strand is added upon it due to complementary nature of nucleotides specific polynucleotide strand will attach to its complementary strands only. And the intensity of shading helps in identifying which polynucleotide stands were there in the sample.

Answer 14

Expert Solution & Answer

Answer 15

Expert Solution & Answer

Answer 16

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 17

Ch. 30 - Prob. 1P Ch. 30 - Prob. 2P Ch. 30 - Prob. 3P Ch. 30 - Prob. 4P Ch. 30 - Prob. 5P Ch. 30 - Prob. 6P Ch. 30 - Prob. 7P Ch. 30 - Prob. 8P Ch. 30 - Prob. 9P Ch. 30 - Prob. 10P

Solution Summary: The author explains how DNA chip technology is also known as the DNA microarray technology.

Concept explainers

Videos

Want to see the full answer?

Chapter 30 Solutions