
Brock Biology of Microorganisms (14th Edition)
14th Edition
ISBN: 9780321897398
Author: Michael T. Madigan, John M. Martinko, Kelly S. Bender, Daniel H. Buckley, David A. Stahl, Thomas Brock
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 2.9, Problem 2MQ
Summary Introduction
The movement molecules through the cell membrane is an important function for transporting of nutrients to the cell. It is carried out actively by transporter systems present in the cell membrane. In prokaryotic life, there are three major transport systems are involved. They are simple transporters, group translocation or phosphotransferase system, and ABC transporters. ABC transporters, the substances are initially bound by a specific protein which then activates ATP hydrolyzing protein and the protein channel to provide energy for transport event through the protein channel
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
What would happen if transcriptome analysis were done on liver and muscle cells?
Chapter 2 Solutions
Brock Biology of Microorganisms (14th Edition)
Ch. 2.1 - Define the terms magnification and resolution.Ch. 2.1 - Prob. 2MQCh. 2.2 - Prob. 1MQCh. 2.2 - Prob. 2MQCh. 2.2 - How can cells be made to fluoresce?Ch. 2.3 - Prob. 1MQCh. 2.3 - Prob. 2MQCh. 2.4 - Prob. 1MQCh. 2.4 - Prob. 2MQCh. 2.5 - How do cocci and rods differ in morphology?
Ch. 2.5 - Prob. 2MQCh. 2.6 - What physical property of cells increases as cells...Ch. 2.6 - How can the small size and haploid genome of...Ch. 2.6 - What are the approximate limits to how small a...Ch. 2.7 - Prob. 1MQCh. 2.7 - Prob. 2MQCh. 2.8 - Prob. 1MQCh. 2.8 - Prob. 2MQCh. 2.9 - Compare and contrast simple transporters, the...Ch. 2.9 - Prob. 2MQCh. 2.10 - Why do bacterial cells need cell walls? Do all...Ch. 2.10 - Prob. 2MQCh. 2.10 - Prob. 3MQCh. 2.11 - Prob. 1MQCh. 2.11 - Prob. 2MQCh. 2.11 - Prob. 3MQCh. 2.11 - Prob. 4MQCh. 2.12 - Prob. 1MQCh. 2.12 - Prob. 2MQCh. 2.12 - Prob. 3MQCh. 2.13 - Prob. 1MQCh. 2.13 - Prob. 2MQCh. 2.14 - Prob. 1MQCh. 2.14 - Chapter Review Why would it be impossible for...Ch. 2.14 - Chapter Review How are magnetosomes and the...Ch. 2.15 - Prob. 1MQCh. 2.15 - Prob. 2MQCh. 2.16 - Prob. 1MQCh. 2.16 - Prob. 2MQCh. 2.16 - Prob. 3MQCh. 2.17 - Prob. 1MQCh. 2.17 - Prob. 2MQCh. 2.18 - Prob. 1MQCh. 2.18 - Prob. 2MQCh. 2.19 - Prob. 1MQCh. 2.19 - Prob. 2MQCh. 2.19 - Prob. 3MQCh. 2.19 - Chapter Review How does scotophobotaxis differ...Ch. 2.20 - Prob. 1MQCh. 2.20 - Prob. 2MQCh. 2.20 - Prob. 3MQCh. 2.21 - Prob. 1MQCh. 2.21 - Prob. 2MQCh. 2.21 - Prob. 3MQCh. 2.22 - Prob. 1MQCh. 2.22 - Prob. 2MQCh. 2.22 - Prob. 3MQCh. 2 - Prob. 1RQCh. 2 - Prob. 2RQCh. 2 - Prob. 3RQCh. 2 - What are the major morphologies of prokaryotic...Ch. 2 - How large can a bacterium be? How small? Why is it...Ch. 2 - Prob. 6RQCh. 2 - Prob. 7RQCh. 2 - Prob. 8RQCh. 2 - Cells of Escherichia coli transport lactose via...Ch. 2 - Prob. 10RQCh. 2 - List several functions of the outer membrane in...Ch. 2 - Prob. 12RQCh. 2 - Prob. 13RQCh. 2 - Prob. 14RQCh. 2 - Prob. 15RQCh. 2 - In a few sentences, indicate how the bacterial...Ch. 2 - Prob. 17RQCh. 2 - Prob. 18RQCh. 2 - Contrast the mechanism for motility in...Ch. 2 - Prob. 20RQCh. 2 - Prob. 21RQCh. 2 - List at least three features of eukaryotic cells...Ch. 2 - Prob. 23RQCh. 2 - Prob. 24RQCh. 2 - Prob. 25RQCh. 2 - Describe the major functions of the endoplasmic...Ch. 2 - Prob. 1AQCh. 2 - Prob. 2AQCh. 2 - Assume you are given two cultures, one of a...Ch. 2 - Prob. 4AQCh. 2 - Assume you are given two cultures of rod-shaped...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Biology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forwardBiology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forward
- Biology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forwardDevelopmental Biology What is the definition of 1 M? (in the context of stock and dilutions)arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage LearningBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
The Cell Membrane; Author: The Organic Chemistry Tutor;https://www.youtube.com/watch?v=AsffT7XIXbA;License: Standard youtube license