Brock Biology of Microorganisms (14th Edition)
Brock Biology of Microorganisms (14th Edition)
14th Edition
ISBN: 9780321897398
Author: Michael T. Madigan, John M. Martinko, Kelly S. Bender, Daniel H. Buckley, David A. Stahl, Thomas Brock
Publisher: PEARSON
bartleby

Concept explainers

bartleby

Videos

Question
Book Icon
Chapter 2.9, Problem 2MQ
Summary Introduction

The movement molecules through the cell membrane is an important function for transporting of nutrients to the cell. It is carried out actively by transporter systems present in the cell membrane. In prokaryotic life, there are three major transport systems are involved. They are simple transporters, group translocation or phosphotransferase system, and ABC transporters. ABC transporters, the substances are initially bound by a specific protein which then activates ATP hydrolyzing protein and the protein channel to provide energy for transport event through the protein channel

Blurred answer
Students have asked these similar questions
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
What would happen if transcriptome analysis were done on liver and muscle cells?

Chapter 2 Solutions

Brock Biology of Microorganisms (14th Edition)

Ch. 2.5 - Prob. 2MQCh. 2.6 - What physical property of cells increases as cells...Ch. 2.6 - How can the small size and haploid genome of...Ch. 2.6 - What are the approximate limits to how small a...Ch. 2.7 - Prob. 1MQCh. 2.7 - Prob. 2MQCh. 2.8 - Prob. 1MQCh. 2.8 - Prob. 2MQCh. 2.9 - Compare and contrast simple transporters, the...Ch. 2.9 - Prob. 2MQCh. 2.10 - Why do bacterial cells need cell walls? Do all...Ch. 2.10 - Prob. 2MQCh. 2.10 - Prob. 3MQCh. 2.11 - Prob. 1MQCh. 2.11 - Prob. 2MQCh. 2.11 - Prob. 3MQCh. 2.11 - Prob. 4MQCh. 2.12 - Prob. 1MQCh. 2.12 - Prob. 2MQCh. 2.12 - Prob. 3MQCh. 2.13 - Prob. 1MQCh. 2.13 - Prob. 2MQCh. 2.14 - Prob. 1MQCh. 2.14 - Chapter Review Why would it be impossible for...Ch. 2.14 - Chapter Review How are magnetosomes and the...Ch. 2.15 - Prob. 1MQCh. 2.15 - Prob. 2MQCh. 2.16 - Prob. 1MQCh. 2.16 - Prob. 2MQCh. 2.16 - Prob. 3MQCh. 2.17 - Prob. 1MQCh. 2.17 - Prob. 2MQCh. 2.18 - Prob. 1MQCh. 2.18 - Prob. 2MQCh. 2.19 - Prob. 1MQCh. 2.19 - Prob. 2MQCh. 2.19 - Prob. 3MQCh. 2.19 - Chapter Review How does scotophobotaxis differ...Ch. 2.20 - Prob. 1MQCh. 2.20 - Prob. 2MQCh. 2.20 - Prob. 3MQCh. 2.21 - Prob. 1MQCh. 2.21 - Prob. 2MQCh. 2.21 - Prob. 3MQCh. 2.22 - Prob. 1MQCh. 2.22 - Prob. 2MQCh. 2.22 - Prob. 3MQCh. 2 - Prob. 1RQCh. 2 - Prob. 2RQCh. 2 - Prob. 3RQCh. 2 - What are the major morphologies of prokaryotic...Ch. 2 - How large can a bacterium be? How small? Why is it...Ch. 2 - Prob. 6RQCh. 2 - Prob. 7RQCh. 2 - Prob. 8RQCh. 2 - Cells of Escherichia coli transport lactose via...Ch. 2 - Prob. 10RQCh. 2 - List several functions of the outer membrane in...Ch. 2 - Prob. 12RQCh. 2 - Prob. 13RQCh. 2 - Prob. 14RQCh. 2 - Prob. 15RQCh. 2 - In a few sentences, indicate how the bacterial...Ch. 2 - Prob. 17RQCh. 2 - Prob. 18RQCh. 2 - Contrast the mechanism for motility in...Ch. 2 - Prob. 20RQCh. 2 - Prob. 21RQCh. 2 - List at least three features of eukaryotic cells...Ch. 2 - Prob. 23RQCh. 2 - Prob. 24RQCh. 2 - Prob. 25RQCh. 2 - Describe the major functions of the endoplasmic...Ch. 2 - Prob. 1AQCh. 2 - Prob. 2AQCh. 2 - Assume you are given two cultures, one of a...Ch. 2 - Prob. 4AQCh. 2 - Assume you are given two cultures of rod-shaped...
Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning
Text book image
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Text book image
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Text book image
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Text book image
Body Structures & Functions Updated
Biology
ISBN:9780357191606
Author:Scott
Publisher:Cengage
Text book image
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
The Cell Membrane; Author: The Organic Chemistry Tutor;https://www.youtube.com/watch?v=AsffT7XIXbA;License: Standard youtube license