The findings of the gene transcription features in the genomes of apes and humans. Introduction: DNA replication takes place before the cell division and prepares the cell for mitosis and meiosis. This process is followed by transcription and translation. Genetic testing is one of the most useful tools in diagnostics to identify genetic abnormalities. It helps to detect the presence of any heritable malformation carried through the genetic makeup of the parents to the offspring.

Question

Want to see the full answer?

Answer 1

Question

Chapter 24, Problem 3IQ

Summary Introduction

To determine: The findings of the gene transcription features in the genomes of apes and humans.

Introduction: DNA replication takes place before the cell division and prepares the cell for mitosis and meiosis. This process is followed by transcription and translation. Genetic testing is one of the most useful tools in diagnostics to identify genetic abnormalities. It helps to detect the presence of any heritable malformation carried through the genetic makeup of the parents to the offspring.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Students have asked these similar questions

The figure below shows RNA-Seq data (RED) for the D. melanogaster transformer (tra) gene obtained from both adult female and male fruit flies. The blue lines indicate the tra gene structure, with thicker lines indicating exons, and thin lines introns. The 5' end of the gene is on the left, and the 3' end of the gene is on the right. Based on these data, the most likely conclusion is: Males and females express identical isoforms of tra Males express more tra RNA than females The female isoform has fewer amino acids The female isoform has more amino acids The male and female isoforms have different 3'UTRs

What is the first step in quantifying the relative amounts of mRNA in different tissues? Would this method be useful in determining which immune system genes might be over-expressed in severe Covid cases? Why or why not? Could quantitative PCR, which uses a DNA-binding dye, to show how many copies of the target DNA sequence could be used to quantify the amount of mRNA in a cell? Would you expect that a metabolically active tissue such as the liver would show more cDNA copies in such a method, compared to less metabolically active tissues such as skin cells? One reason that the types and amounts of mRNAs are quantified in different tissue types is to compare which genes are activated and which are inactive. It used to be thought that any gene that was transcribed was automatically translated. The discovery of RNA-degrading systems shows that the real situation in cells is more complemented. Do you believe that a larger amount of mRNA of a given type, say for alpha hemoglobin in…

By whole-exome sequencing, you have identified an early termination mutation in KLHL4 in a human patient with an undiagnosed blood vessel anomaly. There is almost nothing known about the function of this gene, and no existing animal models! To begin to understand its function, you decide to use the zebrafish model. You first want to know where in the embryo this gene is expressed. Which technique would you use to identify the cell type that expresses klhl4 mRNA in zebrafish embryos? You find that this gene is expressed in endothelial cells, which line blood vessels. Intrigued by this finding, you next decide to disrupt the gene in zebrafish using CRISPR/Cas9. The DNA sequence that you want to target is below. What is the sequence of your 20-base guide RNA? 5’ TAGCAATTATGCGCGCTAGCAATTGCGTAGGTCATAATGCAGCTGAC 3’ 3’ ATCGTTAATACGCGCGATCGTTAACGCATCCAGTATTACGTCGACTG 5’ After injecting the gRNA with Cas9, what are potential outcomes? Enter true or false.…