Concept explainers
(a)
Interpretation: The base sequence for initially synthesized RNA for the DNA template strand
Concept introduction: DNA strand contains a complementary base pairing between A-T and C-G. The complementary strands are antiparallel to each other. RNA molecule contains the similar base pairing but the base thymine is replaced by uracil.
(a)
Answer to Problem 22.81EP
The base sequence for initially synthesized RNA for the DNA template strand
Explanation of Solution
The given DNA template strand is
(b)
Interpretation: The base sequence for initially synthesized RNA for the DNA template strand
Concept introduction: DNA strand contains a complementary base pairing between A-T and C-G. The complementary strands are antiparallel to each other. RNA molecule contains the similar base pairing but the base thymine is replaced by uracil.
(b)
Answer to Problem 22.81EP
The base sequence for initially synthesized RNA for the DNA template strand
Explanation of Solution
The given DNA template strand is
(c)
Interpretation: The base sequence for initially synthesized RNA for the DNA template strand
Concept introduction: DNA strand contains a complementary base pairing between A-T and C-G. The complementary strands are antiparallel to each other. RNA molecule contains the similar base pairing but the base thymine is replaced by uracil.
(c)
Answer to Problem 22.81EP
The base sequence for initially synthesized RNA for the DNA template strand
Explanation of Solution
The given DNA template strand is
(d)
Interpretation: The base sequence for initially synthesized RNA for the DNA template strand
Concept introduction: DNA strand contains a complementary base pairing between A-T and C-G. The complementary strands are antiparallel to each other. RNA molecule contains the similar base pairing but the base thymine is replaced by uracil.
(d)
Answer to Problem 22.81EP
The base sequence for initially synthesized RNA for the DNA template strand
Explanation of Solution
The given DNA template strand is
Want to see more full solutions like this?
Chapter 22 Solutions
EBK GENERAL, ORGANIC, AND BIOLOGICAL CH
- A mutant DNA strand was transcribed then translated to proteins. a. What is the protein product of the mutant DNA strand? The sequence of the mutant strand is shown below: 5'-TGCCATAACTGTTCGTACTGGCAAATTGCC-3' 3'-ACGGTATTGACAAGCATGACCGTTTAACGG-5' b. The mutation altered the sequence of the wild type template DNA such that a degenerate codon for a basic amino acid in the wild type was converted to a non-degenerate codon resulting in the sequence for the mutant strand shown. What was the original amino acid? c. Compare the charges and pl of the mutant peptide and the normal (wild- type) peptide at physiological pH?arrow_forwardThe following is a section of DNA removed from a cell nucleus:5' ATGAAATAATCAGTTAACAGCAGVFCCGATTTTTATACT 3'strand 3' TACITTATTAGTCAAVFGTCGTCAAGGCTAAAAATATGA 5'strand a. What does the Central Dogma state? b. Label the strands above as the "sense" or "antisense" strand. c. Using the chart below, transcribe ONLY the gene into mRNA and then translate the gene into its amino acid sequence, d. What would happen to the gene if the adenosine mutates to a thymine where the arrow indicates? 3' TACTTTATTAGTCAATTGTCGTCAAGGCTAAAAATATGA 5' What type of mutation is this?arrow_forwardWhat is the sequence of the DNA template strand from which each of the following mRNA strands was synthesized? a. 5 '–UGGGGCAUU–3 ' c. 5 '–CCGACGAUG–3 'b. 5 '–GUACCU–3 ' d. 5 '–GUAGUCACG–3 'arrow_forward
- The mature m-RNA is capped by which of the following heterocyclic bases (or which of the following heterocyclic bases are present on the cap of a mature m-RNA? a. 5-methylcytosine b. 5-methyguanine c. 7-methylguanine d. 7-methylcytosinearrow_forwardThe following sequence of nucleotides is found in a single-stranded DNA template:ATTGCCAGATCATCCCAATAGATAssume that RNA polymerase proceeds along this template from left to right a. Which end of the DNA template is 5′ and which end is 3′?b. Give the sequence and identify the 5′ and 3′ ends of the RNA transcribed from this templatearrow_forwardWill the pairs of sequence might be found at the ends of an insertion sequence? a.5′–TTTCGAC–3′ and 5′–CAGCTTT–3′arrow_forward
- A DNA antisense strand contains the following nucleotide base sequence: AGT GTC TTT GAC From this, what is the nucleotide sequence of the mRNA strand that is transcribed? a. AGU GUC UUU GAC b. UCU CUG UUU CAG UCA CAG AAA CUG d. TCA CAG AAA CTG C. How many amino acids does the mRNA strand above code for? .arrow_forwardThe following is a template strand of DNA: 3' - ATAGCGTACAAGTGGATT - 5'. What mRNA would be produced from transcribing this DNA template strand? a. 5' - TATCGCATGTTCACCTAA - 3' O b.5' - UAUCGCAUGUUCACCUAA - 3' c. 5' - AUGUUCACCUAA - 3' d. 5' - UTGTTCUCCTUU - 3' e. 5' - AAUCCACUUGUACGCUAU - 3' QUESTION 37 The following is a template strand of DNA: 3' - ATAGCGTACAAGTGGATT - 5'. What sequence of amino acids would be produced as a result of transcribing and translating this DNA template? a. Met - Asn - Leu - Phe - His - [STOP] Ob. Tyr - Arg - Met - Phe - Thr - [STOP] O C. Asn - Pro - Leu - Val - Arg - Tyr d. Met - Phe - Thr - [STOP] e. None of the above O O O Oarrow_forwardThe following is a template strand of DNA: 3' - ATAGCGTACAAGTGGATT - 5'. What mRNA would be produced from transcribing this DNA template strand? a. 5' - TATCGCATGTTCACCTAA - 3' b.5' - UAUCGCAUGUUCACCUAA - 3' c. 5' - AUGUUCACCUAA - 3' d. 5' - UTGTTCUCCTUU - 3' O e. 5' - AAUCCACUUGUACGCUAU - 3'arrow_forward
- The short Okazaki fragments are Select one: a. spliced together by DNA ligase b. glued together by RNA primers c. fused together by DNA polymerase d. formed into the lagging strand without splicingarrow_forwardFor each example: a. fill in the complimentary DNA strand b. fill in the correct mRNA bases by transcribing the bottom DNA code c. fill in the correct tRNA bases d. translate the MRNA codons to find the correct amino acids Example #1 5' 3' (A (A DNA MRNA TRNA Amino Acidsarrow_forwardIs each of the following mutations a transition, transversion, addition,or deletion? The original DNA strand is 5′–GGACTAGATAC–3′(Note: Only the coding DNA strand is shown.)A. 5′–GAACTAGATAC–3′B. 5′–GGACTAGAGAC–3′C. 5′–GGACTAGTAC–3′D. 5′–GGAGTAGATAC–3′arrow_forward
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning