A mutant DNA strand was transcribed then translated to proteins. a. What is the protein product of the mutant DNA strand? The sequence of the mutant strand is shown below: 5'-TGCCATAACTGTTCGTACTGGCAAATTGCC-3' 3'-ACGGTATTGACAAGCATGACCGTTTAACGG-5' b. The mutation altered the sequence of the wild type template DNA such that a degenerate codon for a basic amino acid in the wild type was converted to a non-degenerate codon resulting in the sequence for the mutant strand shown. What was the original amino acid? c. Compare the charges and pl of the mutant peptide and the normal (wild- type) peptide at physiological pH?

Use the Genetic Code below to help you answer the following questions.  The nucleotide sequence of a hypothetical eukaryotic gene is:  3'- CCC CAT CAG TCA AGG GAA - 5'   a. Provide the mRNA of the non-mutated gene.    b. Provide the linear amino acid sequence of the non-mutated gene. üü   c. Examine the mutated DNA sequence below. What would be the sequence of the mRNA? ü           Mutated DNA sequence:   3' CCC CAC AGT CAA GGG AA 5'   d. Provide the linear amino acid sequence of the mutated gene and identify the type of mutation.    e. Comment on the consequences of this type of mutation?

Give typing answer with explanation and conclusion Suppose that RNA polymerase was transcribing a eukaryotic gene with several introns all contained within the coding region. In what order would the RNA polymerase encounter the elements in the DNA sequence of the gene? Earliest encountered promoter 5' UTR translation initiation codon splice branch point stop codon 3' UTR Latest encountered

8.) Answer the following questions regarding the following DNA sequence. 3'TACGGGGATAGCCGGCGAATTAAATAGCTGTC - 5" A.) What is the MRNA sequence that would result from transcription of this sequence? Assume that the DNA would be read from left to right. What is the amino acid sequence that would result from translation of B.) the MRNA resulting from the sequence? See Codon Table on next page. 20 C.) What is the anti-codon found on the tRNA that would deliver the amino acid for the first codon in the MRNA sequence? D.) If the fourth nucleotide in the DNA sequence were deleted due to a mutation during DNA replication, what would the resulting amino acid sequence be? What type of mutation is this? E.) What impact would the mutation in the DNA sequence in PART D have on the function of the protein produced from original sequence? Why?