Essentials of Genetics (9th Edition) - Standalone book
9th Edition
ISBN: 9780134047799
Author: William S. Klug, Michael R. Cummings, Charlotte A. Spencer, Michael A. Palladino
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 18, Problem 11PDQ
Annotation involves identifying genes and gene-regulatory sequences in a genome. List and describe characteristics of a genome that are hallmarks for identifying genes in an unknown sequence. What characteristics would you look for in a prokaryotic genome? A eukaryotic genome?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
You have assembled a new prokaryotic genome and are annotating the genes. If you were to search for highly conserved sequences necessary for normal gene expression, what type of annotation are you doing?
Group of answer choices
ad hoc annotation
homology based annotation
preliminary annotation
ab initio annotation
Genomic sequencing cannot be used to:
Predict a protein coding gene
Predict structure and function of a protein encoded in a gene
Locate similar sequences (sequence homology)
Locate repetitive sequences
Predicting alternative splicing patterns
What is a database? What types of information are stored within adatabase? Where does the information come from? Discuss theobjectives of a genome database.
Chapter 18 Solutions
Essentials of Genetics (9th Edition) - Standalone book
Ch. 18 -
CASE STUDY | Your microbiome may be a risk factor...Ch. 18 - CASE STUDY|Your microbiome may be a riskfactor for...Ch. 18 -
CASE STUDY | Your microbiome may be a risk...Ch. 18 -
HOW DO WE KNOW?
1. In this chapter, we focused on...Ch. 18 - Review the Chapter Concepts list on page 345. All...Ch. 18 - Prob. 3PDQCh. 18 - Prob. 4PDQCh. 18 - Prob. 5PDQCh. 18 - Prob. 6PDQCh. 18 - Prob. 7PDQ
Ch. 18 -
8. BLAST searches and related applications are...Ch. 18 - Describe the human genome in terms of genome size,...Ch. 18 - Prob. 10PDQCh. 18 -
11. Annotation involves identifying genes and...Ch. 18 - Through the Human Genome Project (HGP), a...Ch. 18 -
13. Describe the significance of the Genome 10K...Ch. 18 - Prob. 14PDQCh. 18 - Prob. 15PDQCh. 18 - Prob. 16PDQCh. 18 -
17. Annotation of the human genome sequence...Ch. 18 - Prob. 18PDQCh. 18 - Prob. 19PDQCh. 18 - Prob. 20PDQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Consider a genome whose length is 1000 bp. "Shotgun" sequencing techniques are applied to the genome, resulting in 20 reads, with an average length of 50 bp. A very important point is that, even though 20×50 = 1000, there is no guarantee that ALL 1000 bp of the genome are represented in the fragments. Calculate the coverage. What does this value mean? Why would it be a good idea to have a coverage greater than 1?arrow_forwardIn a genome project, the following genomic DNA sequences were obtained. Assemble the sequences into a contig. Using the assembled sequence, perform a BLASTn search. Does the search produce sequences similar to your assembled sequence? 5’ TCGGGGTCCTGGGATCTCATCACTGCAGCGC 3’ 5’ACTGCAGCGCTTTCCCAGCGGGCGGTGGTAC 3’ 5’GGGCGGTGGTACTCGGGAAGTCAGGAGTGTT 3’ 5’AGGAGTGTTTAAAACCTGGGGACTGGTTTTG 3’ 5’TGGTTTTGGGGGCGCTGAAGGCAGCGCAGGA 3’arrow_forwardAssume 2x108 reads of 75 bps long are obtained from a next-generation sequencing experiment to sequence a human genome. Suppose the length of the human genome is 3x109 bps. What is the depth (i.e., coverage) of the sequencing?arrow_forward
- Place the steps necessary to perform RNA-Seq in the correct order. Drag the text blocks below into their correct order. Reset MAAAAAAAAAKK MAAAAAAAAAAM Compare sequences to known genome sequence. Create cDNA using reverse transcription with primers complementary to linkers. Attach linkers to the ends of the RNAs. Perform next-generation DNA sequencing. Isolate RNA from cells or tissues of interest. Fragment the RNAs.arrow_forwardIf you have access to the necessary computer software, make asequence file and analyze it in the following ways: What is thetranslated sequence in all three reading frames? What is the longest open reading frame? Is the sequence homologous to any known sequences? If so, does this provide any clues about the function of the sequence?arrow_forwardEach of the following describes a distinctive step in a genomic technology or experimental design. Match the name of the technology or experimental design to the description. Answers may be used more than once or not at all. Add fluorescent tags onto the single-stranded sample of nucleic acids before the sample is applied to a glass slide. [ Choose ]When aligned to a reference genome, read depth indicates duplications and deletions. [ Choose ]A spot appears as a mix of two fluorescent colors if the individual is heterozygous. [ Choose ]An experimental design that relies on identifying unrelated individuals that have one of two phenotypes, then looking for a correlation between individual phenotype and genotype. [ Choose ] choices: GWAS, RNA microarray, RNA sequencing, DNA microarray, quantitative genetics, family study, genomic resequencingarrow_forward
- Jackson Wang is a biologist working with the genetics of a thermophilic bacterium. He cloned a heat shock gene from the bacteria for further analysis. After cloning, he isolated the plasmid carrying his gene of interest for sequencing. Jackson finally received the nucleotide sequence of his gene. Explain in detail how he could verify whether the nucleotide sequence matches his gene of interest using the bioinformatics databases available.arrow_forwardWhat advantages do cDNA libraries provide over genomic DNA libraries? Describe cloning applications where the use of a genomic library is necessary to provide information that a cDNA library cannot.arrow_forwardWhat is domain? And Why is it complicated to classify and study domains purely using sequence analysis?arrow_forward
- Ihsan is a biologist working with the genetics of a psychrophilic bacterium. He cloned an antifreeze gene from the bacteria for further analysis. After cloning, he isolated the plasmid carrying his gene of interest for sequencing. Ihsan finally received the nucleotide sequence of his gene. Explain in detail how he could verify whether the nucleotide sequence matches his gene of interest using the bioinformatics databases available.arrow_forwardCompare the composition of genes and upstream regions of DNA in bacteria, Archaea and eukaryotes in table formatarrow_forwardDescribe the difference between Sanger based sequencing and Next Generation Sequencing (NGS). Why is NGS advantageous over Sanger based sequencing?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license