Campbell Biology
12th Edition
ISBN: 9780135188743
Author: Urry
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 17, Problem 10TYU
Summary Introduction
To propose: An evolutionary explanation for the statement that most amino acids are coded by a similar set of codons.
Concept introduction:
The genetic information of DNA is based on the
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
. The genetic code is thought to have evolved to maximize genetic stability
by minimizing the effect on protein function of most substitution muta-
tions (single-base changes). We will use the six arginine codons to test this
idea. Consider all of the substitutions that could affect all of the six arginine
codons.
(a) How many total mutations are possible?
(b) How many of these mutations are "silent," in the sense that the mutant
codon is changed to another Arg codon?
(c) How many of these mutations are conservative, in the sense that an Arg
codon is changed to a functionally similar Lys codon?
Taking start and stop codon into consideration, if we have an mRNA sequence with 30 nucleotides, how many amino acids would be found in the resulting polypeptide (protein chain)? Why?
SCIENTIFIC INQUIRY Knowing that the genetic code is almostuniversal, a scientist uses molecular biological methods toinsert the human β-globin gene (shown in Figure 17.12) intobacterial cells, hoping the cells will express it and synthesizefunctional β-globin protein. Instead, the protein produced isnonfunctional and is found to contain many fewer amino acidsthan does β-globin made by a eukaryotic cell. Explain why
Chapter 17 Solutions
Campbell Biology
Ch. 17.1 - Prob. 1CCCh. 17.1 - What polypeptide product would you expect from a...Ch. 17.1 - Prob. 3CCCh. 17.2 - MAKE CONNECTIONS In a research artide about...Ch. 17.2 - What enables RNA polymerase to start transcribing...Ch. 17.2 - WHAT IF? Suppose X-rays caused a sequence change...Ch. 17.3 - There are about 20,000 human protein-coding genes....Ch. 17.3 - How is RNA splicing similar to how you would watch...Ch. 17.3 - Prob. 3CCCh. 17.4 - What two processes ensure that the correct amino...
Ch. 17.4 - Prob. 2CCCh. 17.4 - Prob. 3CCCh. 17.4 - WH AT IF? In eukaryotic cells, mRNAs have been...Ch. 17.5 - What happens when one nucleotide pair is lost from...Ch. 17.5 - MAKE CONNECTIONS Individuals heterozygous for the...Ch. 17.5 - WHAT IF? DRAW IT The template strand of a gene...Ch. 17.5 - Prob. 4CCCh. 17 - Describe the process of gene expression, by which...Ch. 17 - What are the similarities and differences in the...Ch. 17 - What function do the 5' cap and the poly-A tail...Ch. 17 - Prob. 17.4CRCh. 17 - What will be the results of chemically modifying...Ch. 17 - In eukaryotic cells, transcription cannot begin...Ch. 17 - Prob. 2TYUCh. 17 - The anticodon of a particular tRNA molecule is (A)...Ch. 17 - Prob. 4TYUCh. 17 - Which component is not directly involved in...Ch. 17 - Using Figure 17.6, identify a 5' 3' sequence of...Ch. 17 - Prob. 7TYUCh. 17 - Would the coupling of the processes shown in...Ch. 17 - Prob. 9TYUCh. 17 - Prob. 10TYUCh. 17 - scientific inquiry Knowing that the genetic code...Ch. 17 - Prob. 12TYUCh. 17 - Prob. 13TYU
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Consequences of the Wobble Hypothesis Point out why Cricks wobble hypothesis would allow fewer than 61 anticodons to be used to translate the 61 sense codons. How might wobble tend to accelerate the rate of translation?arrow_forwardThe figure below shows a ribosome in the process of translating an mRNA with a sequence: 5'...AUGCCGUAUGCUCUUUAA..3' a) The right side shows the ribosome with an empty A site aligned with the codon 5'UAU3'. The next tRNA to occupy the A site on the ribosome will have what anti-codon sequence (label 5' and 3')? Keep in mind the wobble pairing rules and make sure your answer is consistent with the genetic code. Explain your answer. b) Suppose, just as the ribosome started translating the mRNA, the cell suddenly lost all of its alanine tRNAs. Using the figure as a guide, draw and label the state the ribosome would arrest in.arrow_forwardRefer to the codon diagram on. Which of the following is a codon that will terminate translation?* ates es Ders rences anline Gly (G) Leu (F) Ser (S) Ty 3. Asp (E) (D) C la Ala (A) GU Cys (C) eriods 1 and 2 G ds P1, Highschool pol MP3, P4 Trp (W) AC Arg (R) Leu (L) Ser (S) Lys (K) C. Pro Asn (N) (P) His The (H) Thu Fri Gin (0) INTLarrow_forward
- The sequence below shows the non-coding strand from the whole of the transcribed region of a very short gene. 5’-GGCTTCTTTAGTACTGGCCAGTGGGATCCAAGTAGGCTGCCATTTCGT-3’ Write out the sequence of the mRNA from this gene in the orientation 5′ → 3′ and, using the genetic code (see Fig. 1. overleaf) deduce the amino acid sequence of the peptide it encodes (NB you should read about the operation of the genetic code prior to attempting this question).arrow_forwardOne remarkable feature of the genetic code is that amino acids with similar chemical properties often have similar codons. thus codons with U or C as the second nucleotide tend to specify hydrophobic amino acids. Can you suggest a possible explanation for this phenomenon in terms of the early evolution of the protein-synthesis machinery?arrow_forwardIn regard to the wobble hypothesis and the fact that cells do not need a full complement of tRNAs for codons. What would the consequences be if a cell lost the tRNA gene with the following anticodon sequences Please explain in depth A. 3'-ACA-5' B. 3'-CUG-5'arrow_forward
- . Explain why a long open reading frame suggests theexistence of a protein-coding exonarrow_forwardMatch each of the following examples with the hypothesis it argues against. Example The gene coding for keratin A gene coding for a tRNA Three genes, each coding for one of the G protein subunits (a, ß and y) A gene that undergoes alternative splicing Hypothesis One gene → one polypeptide One gene→→ one enzyme One gene → one protein One gene → one proteinarrow_forwardThe following segment of DNA in a hypothetical model organism encodes a polypeptide containingSEVEN amino acids. Pretend this short polypeptide is a completely functional enzyme. DNA tripletsencoding the translation initiation (or start) codon and a stop codon are included in the sequence.3 •GGGTACGATCGGAAAGTTGGTTCICCGGTATAGCTG5'5•CCCATGCTAGCCTTTCAACAAAGAGGCCATATCGAC.3'a. Label which of the DNA strands is the template strand and which is coding strand. b. Below, show sequence and the polarity of the mRNA encoded by this 'gene'. Determine theamino acid sequence of the polypeptide (use three letter codes for the amino acids) andidentify the N- and C- terminal ends of the polypeptide. please help. I am confused. c. Which of the 7 side chains in this polypeptide can form hydrogen bonds with polar molecules(like water)? Place a circle around these.d. Some amino acids on a polypeptide can be modified post-translationally. Thesemodifications may have some effect on the function of the…arrow_forward
- Oxytocin is a small peptide hormone. It contains a nine amino acid sequence shown below: CYIQNCPLG 33 How many nucleotides would be found in the mRNA for this protein? Suggest an mRNA sequence for the peptide. Write in as 5' XXX 3' (no spaces between nucleotides). Keep in mind, for a protein to be synthesized it needs to include a start codon and a stop codon. Suggest a complementary template DNA sequence based on the MRNA sequences suggested above. Write in as 3' XXX 5' (no spaces between nucleotides).arrow_forwardcodon: 1 2 3 4 5 6 7 sequence: TAC ATG GAC AAT GAT TAG GGG 1. What is the sequence of the peptide that would result following translation with a ribosome? Write your answer like this Met Ala Gly...... 2. What mutation(s) would change the peptide to Met Asp Asn Gly Leu Gly ? Use the codon numbers to help describe where the mutation is located . What mutation(s) would eliminate peptide translation? Use the codon numbers to help describe where the mutation is locatedarrow_forward. In bacterial genes, as soon as any partial mRNA transcriptis produced by the RNA polymerase system, the ribosome assembles on it and starts translating. Draw a diagram of this process, identifying 5′ and 3′ ends of mRNA,the COOH and NH2 ends of the protein, the RNA polymerase, and at least one ribosome. Why couldn’t this system work in eukaryotes?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning