Biology (MindTap Course List)
11th Edition
ISBN: 9781337392938
Author: Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 14, Problem 14TYU
Summary Introduction
To determine: The reason why rate of transcription of gene is decreased when DNA that is situated several thousand bases upstream from the gene is removed.
Introduction: Gene regulation consists of many mechanisms that the cell uses to decrease or increase the production of certain gene products. The gene regulation in the bacteria mainly takes place in the level of transcription. In the eukaryotes, the gene regulation takes place in the level of transcription, post transcription, translation, and post translation.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Refer to the double stranded DNA molecule with the sequence below to answer the following questions:
5’ATATGGGTCTCGATAGGGCTGTTTTCTCCGGC 3’
3’TATACCCAGAGCTATCCCGACAAAAGAGGCCG 5’
Which strand functions as the transcription template, the top one or the bottom one? Explain your reasoning.
What is the mRNA transcript and polypeptide from this strand? In the space below, copy the DNA strand that is transcribed, and write the mRNA transcript and polypeptide chain below it. Align the mRNA and polypeptide so that it is clear which DNA bases they came from.
DNA strand:
mRNA:
amino acid sequence:
Consider the generalized structure of a eukaryotic gene, and the RNA it encodes. Of the options listed below, which one set of features determines the length of the primary RNA in base pairs, before any processing has occurred?
The exon and intron sequences
The promoter and enhancer sequences
The start and stop codons for translation
The transcription start and termination sequences
Below is a double-stranded DNA:
ATATGTGGTCTCGGTCCGTTAGGCAAT
TATACACCAGAGCCAGGCAATCCGTTA
Which strand functions as the transcription template, the top one or the bottom one? Explain your reasoning
What is the mRNA transcript and polypeptide from this strand? In the space below, copy the DNA strand that is transcribed, and write the mRNA transcript.
Identify the polypeptide chain below it. Align the mRNA and polypeptide so that it is clear which DNA bases they came from.
Chapter 14 Solutions
Biology (MindTap Course List)
Ch. 14.1 - Explain why bacterial and eukaryotic cells have...Ch. 14.1 - Prob. 1CCh. 14.1 - Prob. 2CCh. 14.2 - Prob. 2LOCh. 14.2 - Distinguish among inducible, repressible, and...Ch. 14.2 - Differentiate between positive and negative...Ch. 14.2 - Prob. 5LOCh. 14.2 - Prob. 1CCh. 14.2 - What structural features does the trp operon share...Ch. 14.2 - Prob. 3C
Ch. 14.2 - Prob. 4CCh. 14.3 - Prob. 6LOCh. 14.3 - Give examples of some of the ways eukaryotic...Ch. 14.3 - Prob. 8LOCh. 14.3 - Prob. 9LOCh. 14.3 - Prob. 10LOCh. 14.3 - Prob. 1CCh. 14.3 - Prob. 2CCh. 14.3 - Prob. 3CCh. 14.3 - Prob. 4CCh. 14.3 - Prob. 5CCh. 14 - The regulation of most bacterial genes occurs at...Ch. 14 - Prob. 2TYUCh. 14 - Prob. 3TYUCh. 14 - Prob. 4TYUCh. 14 - Inactive genes tend to be found in (a) highly...Ch. 14 - Prob. 6TYUCh. 14 - Which of the following is characteristic of genes...Ch. 14 - Through alternative splicing, eukaryotes (a)...Ch. 14 - A mutation that inactivates the repressor gene of...Ch. 14 - Which of the following is an example of positive...Ch. 14 - Prob. 11TYUCh. 14 - PREDICT Compare the types of bacterial genes...Ch. 14 - INTERPRET DATA Develop a simple hypothesis that...Ch. 14 - Prob. 14TYUCh. 14 - Prob. 15TYUCh. 14 - EVOLUTION LINK Suggest why evolution resulted in...Ch. 14 - Prob. 17TYU
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Here is a schematic map with a scale of a eukaryotic gene. How long is the primary mRNA transcript produced from this gene? Termination Start codon Stop codon sequence -35 -10 Exon 1 Intron 1 Exon 2 Intron 2 Exon 3 3 4 Genomic sequence (kb) (k = kilo = 1,000) %3D 5000 bases 4200 bases 3200 bases 4800 basesarrow_forwardConsider the following segment of a template strand of DNA: Part A -ATA AGC TTC GAC- What is the mRNA produced for the segment? -UAU-UCG-AAG-CUC- Part B Complete previous part(s) • Part C What is the mRNA if a mutation changes AGC to AAC? Part D Complete previous part(s) Part E What is the MRNA produced if G is inserted at the beginning of the DNA segment?arrow_forwardThe code for a fully functional protein is actually coming from an mRNA transcript that has undergone post-transcriptional processing which is essentially way too different from the original code in the DNA template. Given: GUC-CAC-UUA-ACC-CCU-GAG-GAG-AAA-UCG-GCC (Protein with known amino acid sequence) Requirement: Original DNA code. Itemize the steps you would take to get to know the original DNA code of the protein in focus.arrow_forward
- Indicate which of the following items are associated with transcription or translation. This could be in prokaryotes or eukaryotes, or both. Group of answer choices: Translation OR Transcription Sigma binds to the promoter mRNA binds to the small ribosomal subunit Spliceosomes remove introns and splice together exons Nucleotides are added from the 5' to 3' end tRNA anticodon binds to the corresponding mRNA codon STOP codon results in terminationarrow_forwardMatch the term with its definition comparing genomic DNA, mRNA, and proteins. You may only use each option ONCE. where transcription starts. where translation ends a chemical group that indicates the first nucleotide that was added to the mRNA a chemical group that indicates the first amino acid that was added to the polypeptide a DNA sequence that is neither transcribed nor translated a non-protein coding region upstream of the start codon in the mRNA promoter complimentary base-pairs with the codon amino-terminus a DNA sequence that is transcribed, but not intron translated [Choose ] stop codon +1 site tRNA 5-prime UTR start codon exon 5-prime triphosphate promoter amino-terminus 5-prime triphosphate stop codonarrow_forwardpoint: Gene expression and gene regulation - Google Chrome 1/mod/quiz/attempt.php?attempt=D1168284&cmid=3372885 5. uc The following segment of DNA codes a protein. The uppercase letters represent exons, the lowercase letters red introns. Draw the pre-mRNA, the mature mRNA and translate the codons using the genetic code to form th protein. Identify the 5'UTR and 3'UTR. out of 5'-AGGAAATGAAATGCCAgaattgccggatgacGGTCAGCaatcgaGCACATTTGTGATTTACCGT-3" g question A B. 三 X2 =三三 囲 Y pre-MRNA:| I囲2 Larrow_forward
- When summarizing the process of transcription in a cell as a gene is used to build a polypeptide, which of these statements accurately reflects the process of transcription? Choose ALL that apply. A - An mRNA molecule is produced in the nucleus of the cell. B - A polypeptide is synthesized based on the sequence of nucleotides on the tRNA molecule. C - The RNA molecules contains three nucleotides in a row whose bases form a codon. D - The ribosome attaches to the DNA to build a polypeptide. E - The resulting RNA molecule is a complement of the gene on the DNA.arrow_forwardHydrogen bonds are important in DNA replication and transcription. They are relatively weak chemical bonds. Why is this a desirable feature for DNA? Describe the effect (s) of changing (mutating) the promoter on the transcription of the DNA strand/gene the promoter controls. What happens to protein synthesis if a nonsense codon is inserted into the gene? Explain why a point mutation does not necessarily change the original amino acid sequence. (Explain silent mutations) Choose any pentapeptide composed of five different amino acids. List the amino acids. Present one messenger RNA codon for each amino acids and the sequence of nucleotides on the DNA that originally coded for your pentapeptide.arrow_forwardWhat is meant by the term ‘redundancy’ in the context of the genetic code?arrow_forward
- What are the role of transcription proteins? Explain briefly at your own wordsarrow_forwarda) What is a mutation in molecular terms? b) a mutation deletes a base in the genomic DNA discuss how that will affect the reading frame and expression product production. Using the following list of codons describe, using diagrams etc., how information stored in the DNA is translated into a peptide. Be sure to discuss all steps. In other words, use a diagram and give me sequences, transcription and translation steps. Show the sequences of the sense and the other DNA strand, the mRNA and the tRNA’s. UUU -phenylalanine UCU -serine AUG –initiation/methionine CUU -leucine ACU -threonine GUU -valine UAA -Terminationarrow_forwardI've attached the table of transcription ans translation for a DNA and Bees work, Genes A and B are exons while C is an intron. Gene A has a silent mutation and Gene B has a nonsense mutation. Please answer the below for me The 3 genes code for different proteins: • Gene A = protein essential for stinger • Gene B = DNA replication enzyme • Gene C = fuzzy hair protein Do you think it matters which protein is mutated? Is one protein more important than another? How would you try to help the bees stay healthy using the information from the mutations?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY