Campbell Essential Biology with Physiology (6th Edition)
6th Edition
ISBN: 9780134711751
Author: Eric J. Simon, Jean L. Dickey, Jane B. Reece
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 12, Problem 15PS
Listed below are 4 of the 13 genome sites used to create a standard DNA profile. Each site consists of a number of short tandem repeats: sets of 4
| Chromosome number | Genetic site | # of repeats |
| 3 | D3S1353 | 4 |
| 5 | D5S818 | 10 |
| 7 | D7S820 | 5 |
| 8 | DBS1179 | 22 |
Imagine you perform a PCR procedure to create a DNA profile for this individual. Which of the following four gels correctly represents the DNA profile of this person?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Listed below are 4 of the 13 genome sites used to create a standard DNA profile. Each site consists of a number of short tandem repeats: sets of 4 nucleotides repeated in a row within the genome. For each site, the number of repeats found at that site for this individual are listed: Imagine you perform a PCR procedure to create a DNA profile for this individual. Which of the following four gels correctly represents the DNA profile of this person?
Design a pair of primers to amplify the entire length of the following 45 base pair sequence.Make each primer 14 bases long. Write the sequences of the primers in 5' to 3' order.(Hint: It will help for you to write out BOTH strands of the DNA sequence listed below.5'-GATGCCCGTTGGATAAATTGGGCGTCTAGAATCGGTCACACTTAG-3'
For the following short sequence of double stranded DNA and the given primers, there will be one major duplex DNA product after many cycles (imagine 10 cycles) of PCR. Provide the sequence of this one major duplex product and label the 5’ and 3’ ends of each strand.
Sequence to be amplified:
5’- GGTATTGGCTACTTACTGGCATCG- 3’
3’- CCATAACCGATGAATGACCGTAGC- 5’
Primers: 5’-TGGC-3’ and 5’-TGCC-3’
Chapter 12 Solutions
Campbell Essential Biology with Physiology (6th Edition)
Ch. 12 - Suppose you wish to create a large batch of the...Ch. 12 - A carrier that moves DNA from one cell to another,...Ch. 12 - In making recombinant DNA, what is the benefit of...Ch. 12 - A paleontologist has recovered a bit of organic...Ch. 12 - Why do DNA fragments containing STR sites from...Ch. 12 - Prob. 6SQCh. 12 - Prob. 7SQCh. 12 - Name the steps of the whole-genome shotgun method.Ch. 12 - Prob. 9SQCh. 12 - Prob. 10IMT
Ch. 12 - Prob. 11IMTCh. 12 - Prob. 12IMTCh. 12 - Some scientists once joked that when the DNA...Ch. 12 - Prob. 14PSCh. 12 - Listed below are 4 of the 13 genome sites used to...Ch. 12 - In the not-too-distant future, gene therapy may be...Ch. 12 - Today, it is fairly easy to make transgenic plants...Ch. 12 - Prob. 18BSCh. 12 - Prob. 19BS
Additional Science Textbook Solutions
Find more solutions based on key concepts
Single penny tossed 20 times and counting heads and tails: Probability (prediction): _______/20 heads ________/...
Laboratory Manual for Holes Human Anatomy & Physiology Fetal Pig Version
2. A gene is a segment of DNA that has the information to produce a functional product. The functional product ...
Genetics: Analysis and Principles
How does trandlation differ from transcription?
Microbiology: Principles and Explorations
What are the cervical and lumbar enlargements?
Principles of Anatomy and Physiology
Describe Mendels conclusions about how traits are passed from generation to generation.
Concepts of Genetics (12th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The short DNA shown below is to be sequenced. Using your knowledge of how the Sanger method works, in the gel diagram, draw in the bands that will appear when DNA polymerase is added to the reaction along with the four different nucleotide mixtures indicated. Note that some of these mixtures are not what would normally be used in a sequencing reaction. Dideoxynucleatides (ddNTPs) are added in relatively small amounts. The asterisk represents a radioactive label. *5' - 3'-ОН 3' – -- ACGACGCAGGACATTAGAC-5' Nucleotide mixtures: A. DATP, DTTP, dCTP, DGTP, ddTTP (given) B. DATP, ATTP, dCTP, AGTP, ddATE C. dTTP, dGTP. ACTP, ddCTP, ddATP D. DATP, dCTP, dTTP, ddGTP A в с D | || ||arrow_forwardA compact disc (CD) stores about 4.8 × 109 bits of information in a 96 cm2 area. This information is stored as a binary code—that is, every bit is either a 0 or a 1. how many bits would it take to specify each nucleotide pair in a DNA sequence? how many CDs would it take to store the information contained in the human genome?arrow_forwardA 13-nucleotide section of an autoradiogram from a Sanger sequencing experiment is depicted in the image below. Based on the band pattern observed here, write out the sequence of both the complementary strand generated during the experiment, and the template strand that is being analyzed. Be sure to clearly indicate the 5' and 3' ends of each. ddATP ddGTP ddCTP || | | ddTTP | 3' 5' Tyne a short answer in the space provided belowarrow_forward
- Below are 9 possible primer pairs.● Determine which primer pair is the best choice.● Explain why the other primers are not good choices.● Calculate the Tm for each primer. Underline or highlight the region of DNA for the primer pair you chose as the best.Forward 1: 5’ gaaataattttgtttaactttaag 3’ Tm =Reverse 1: 5’ gtttaagacaaaatagtctgg 3’ Tm =Forward 2: 5’ gtaactcagctttcaggtcg 3’ Tm =Reverse 2: 5’ tctcggaatgttgcaacagc 3’ Tm =Forward 3: 5’ agattagcggatcctacctg 3’ Tm =Reverse 3: 5’ atgtgtaatcccagcagcag 3’ Tm =Forward 4: 5’ cattgattatttgcacggcg 3’ Tm =Reverse 4: 5’ aaaatcttctctcatccgcc 3’ Tm =Forward 5: 5’ tccataagattagcggatcc 3’ Tm =Reverse 5: 5’ tgcaagcttggctgttttgg 3’ Tm =Forward 6: 5’ gatcctacctgacgcttttta 3’ Tm=Reverse 6: 5’ aaataatgaattcgagctcggt 3’ Tm =Forward 7: 5’ataaaaaaatcgagataaccgtt 3’ Tm =Reverse 7: 5’aggtcgactctagaggatc 3’ Tm =Forward 8: 5’ctacctgttccatggccaac 3’ Tm=Reverse 8: 5’ ttcgggcatggcactcttg 3’ Tm=Forward 9: 5’ tccataagattagcggatcc 3’ Tm =Reverse 9: 5’…arrow_forwardFigure 9-22 shows the first steps in the process of making a DNA microarray, or DNA chip, using photolithography. Describe the remaining steps needed to obtain the desired sequences (a different fournucleotide sequence on each of the four spots) shown in the first panel of the figure. After each step, give the resulting nucleotide sequence attached at each spot.arrow_forwardThe following is the base sequence of DNA that codes for first eight amino acids of the β chain of hemoglobin. The β chain of hemoglobin contains a total of 147 amino acids so this is a small part of the entire gene. DNA Template Strand: TACCACGTGGACTGAGGACTCCTC 1. What is the minimum number of DNA nucleotides in this whole gene? 2. What is the sequence of bases on the strand of DNA that is complementary to the template strand? 3. What mRNA will be formed from the template strand of DNA?arrow_forward
- After restriction enzymes cut, they contain unpaired bases. Type II restriction enzymes leave ends that may be 5' overhanging, 3' overhanging, or blunt. In all cases each end is left with a 3' OH and a 5' phosphate. All blunt ends, and any complementary overhanging ends may be re-ligated with T4 DNA ligase, as long as at least one 5'- phosphate is present. In the tables below G^AATTC means that the end after cutting with enzyme will be: -----G 3' -----CTTAA 5' GTGCA^C means that the end will be: -----GTGCA 3' -----C 5' Which RE’s from table below have a 5’ overhang? Which ones have a 3’ Overhang? AccI GT^CGAC BamHI G^GATCC ClaI AT^CGAT NsiI ATGCA^T PstI CTGCA^G BglII A^GATCT TaqI T^CGAarrow_forwardA Sanger product of the sequencing of a template DNA is presented +ddTTP +ddATP +ddCTP +ddGTP Mononucleotide Pentanucleotide Trinucleotide Dinucleotide 11-nucleotide Hexanucleotide Octanucleotide Tetranucleotide 16-nucleotide Decanucleotide Nonanucleotide Heptanucleotide 17-nucleotide 15-nucleotide 13-nucleotide 12-nucleotide 18-nucleotide 20-nucleotide 14-nucleotide 19-nucleotide 21-nucleotide 1. Determine the sequence of template DNA 2. Determine the mRNA sequence from this template DNA 3. Determine the the sequence of protein product derived from that DNAarrow_forwardGiven the DNA sequence of the restriction enzyme: gi|6329444|dbj|AB034757.1| Hynobius retardatus mRNA for larval beta-globin, complete cds GCAGAATCTGACTCAAGAAATCCCTCCTCACCCAACACCACCAGCAGCCATGGTTCACTGGACAGCAGAGGAGAAGGCAGCCATCAGCTCTGTGTGGAAGCAGGTGAACGTGGAGAGCGATGGACAGGAGGCCCTGGCCAGGTTGCTGATCGTCTACCCCTGGACCCAGAGATACTTCAGCTCTTTTGGGGACCTGTCGAGCCCAGCTGCCATTTGTGCCAACGCCAAGGTCCGTGCCCATGGCAAGAAGGTCCTGTCCGCCCTGGGAGCCGGCGCCAACCACCTGGATGACATCAAAGGCAACTTTGCTGATCTGAGCAAGCTTCACGCAGACACACTCCATGTGGACCCCAATAACTTCCTGCTCCTGGCAAACTGCCTGGTGATCGTCTTGGCCCGCAAGCTGGGAGCCGCCTTCAACCCTCAAGTCCATGCGGCCTGGGAGAAGTTCCTGGCCGTCTCCACCGCGGCTCTGTCCAGAAACTACCACTAGAGACTGGTCTTTGGGTTTAATTCTGTGAACGTCCCTGAGACAAATGATCTTTCAATGTGTAAACCTGTCATTACATCAATAAAGAGACATCTAACAAAAAAAAAAAAAAAAAAAAAAAAAA Identify two blunt-end cutters Identify two sticky-end cutters. For each, Provide the sequence of the Restriction enzyme, Highlight using a specific color where the DNA sequence where the restriction enzyme will cut the DNA Indicate the…arrow_forward
- That's the result of Gel electrophoresis of genomic DNA ( Of genomic DNA extraction experiment), please discuss the results and label and name the image to illustrate the answer? - Marker band sizes in gel: From top (well side) to bottom the bands have the following size in base-pair/bp- 6751,3652,2827,1568,1118,825,630arrow_forwardThe following is the base sequence of DNA that codes for first eight amino acids of the β chain of hemoglobin. The β chain of hemoglobin contains a total of 147 amino acids so this is a small part of the entire gene. DNA Template Strand: TACCACGTGGACTGAGGACTCCTC 1. What is the minimum number of DNA nucleotides in this whole gene? 3 2. What is the sequence of bases on the strand of DNA that is complementary to the template strand? 3' TACCACGTGGACTGAGGACTCCTC 5' . 5' ATGGTGCACCTGACTCCTGAGGAG 3' 3. What mRNA will be formed from the template strand of DNA? Sequence of mRNA formed from DNA template strand is shown below: 3' TACCACGTGGACTGAGGACTCCTC 5' . 5'AUGGUGCACCUGACUCCUGAGGAG 3 4. What amino acids will this mRNA code for? 5. If the 20th base in the template strand of the DNA is changed from T to A, rewrite the new template strand below. 6. When the template strand of the DNA is changed, this is referred to as a mutation. What kind of mutation is…arrow_forwardAlign two sequences: horizontal – GGAATGG, vertical – ATG, m=1, mm = 0, g=-1. Use the table below for the NW matrix. Write down and score all optimal global alignments. Complete the NW matrix below and show the alignment paths. Use the arrows and circles for the matrix and paths. Click the shapes and move them using your keyboard arrow keys (or drag). Click the shapes and then right-click to copy/paste or click and use Ctrl + C to copy, then Ctrl + V to paste (in Windows MS Word). 0000 Align and score 4 optimal alignments here. the first line, v sequence in the second line and Each alignment should have h sequence individual scores for each alignment position in the third line.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY