Concept explainers
Define the following terms as described in this chapter:
balanced polymorphism
heterozygous advantage
balancing selection
intron
hemoglobin tetramer
hereditary anemia
exon
heterozygous
recessive
molecular disease
restriction endonuclease
homozygous
gel electrophoresis
restriction fragment length polymorphism (RFLP)
SNP
electrophoretic mobility
Southern blot
molecular probe
northern blot
antibody probe
western blot
To analyze:
Referring to the chapter, define the following terms:
balanced polymorphism
heterozygous advantage
balancing selection
intron
hemoglobin tetramer
hereditary anemia
exon
heterozygous
recessive
molecular disease
restriction endonuclease
homozygous
gel electrophoresis
restriction fragment length polymorphism (RFLP)
SNP
electrophoretic mobility
Southern blot
molecular probe
northern blot
antibody probe
western blot
Introduction:
These are the different terms used in molecular biology. Some terms refer to molecular techniques used to identify target molecules while some refer to the molecules involved in molecular biology studies.
Explanation of Solution
Balanced polymorphism – It describes the end result of balancing selection, a result in which the loss of anallele because of selection against one of its phenotypes isbalanced by natural selection in favor of the allele for anotherphenotype.
Heterozygous advantage –
It refers to the larger relative fitness of heterozygous genotype than the homozygous genotype (it can be either homozygous recessiveor dominant)
Balancing selection –It is a form of natural selection that favors heterozygous genotype and leads to stable equilibrium frequency of alleles in a population.
Intron – An intron is a sequence of nucleotides within a gene that is removed by RNA splicing during formation of mature mRNA. Introns are non-coding regions of DNA.
Hemoglobin tetramer – Hemoglobin is a protein with quaternary structure. The hemoglobin tetramer contains two protein chains
Hereditary anemia –Hereditary anemia is a rare, genetically transmitted blood disorder characterized by premature destruction of red blood cells. Mutations of
Exon – It is a segment of DNA molecule or RNA molecule that contains information coding for a protein. Exons are disturbed by non-coding introns in the DNA sequence.
Heterozygous –Presence of two different types of alleles of a particular gene in a diploid cell is known as heterozygous.
Recessive – It is the type of allele of a particular gene that is not expressed in the presence of other dominant allele. It is a subordinate or submissive allele.
Molecular disease – It is a term that denotes a disease caused by a variation in the molecular structure of a protein. For example – Sickle Cell Disease (SCD)
Restriction endonuclease – Restriction endonucleases are a special class of DNA digesting enzymes that act only on specific DNA sequences. These enzymes are also recognized as molecular scissors.
Homozygous - Presence of two similar alleles of a particular gene in diploid cell is known as homozygous.
Gel electrophoresis - It is an analytical technique used to separate different protein or nucleic acid molecules from one another in an electric field on the basis of their charge, size, and shape.
Restriction fragment length polymorphism (RFLP) – In the presence of SNPs, DNA samples from two individuals exposed to the same restriction enzyme will produce a different number or a difference in length of restriction fragments. These inherited DNA sequence variations are known as restriction fragment length polymorphism (RFLP)
SNP –The most common kind of DNA sequence difference between organisms of the same species is avariation of single nucleotides; this type of difference is known as Single Nucleotide Polymorphism (SNP)
Electrophoretic mobility – It is a term used to describe the rate of a molecule’s electrophoretic migration or its final position in the gel. Electrophoretic mobility of smaller molecules of nucleic acid or protein is higher than that of the larger molecules.
Southern blot –It is a molecular biology method used for detection of a specific DNA sequence in DNA samples. It consists of transfer of electrophoresis – disconnected DNA fragments to a filter membrane and subsequent fragment detection by probe hybridization.
Molecular probe – In molecular biology, molecular probe is a single stranded nucleic acid, labeled with a detectable marker, and it is capable to bind it specific target nucleic acid. It is used to identify target nucleic acid sequence or target proteins following electrophoresis.
Northern blot – It is a molecular biology technique used to study gene expression by detection of isolated mRNA or RNA in a sample by complementary base pairing of probe and a segment of the target nucleotide sequence.
Antibody probe – It is an antibody protein labeled with a detectable marker that attaches to specific target proteins.
Western blot - It is a molecular biology technique used to transfer protein from an electrophoresis gel to a permanent membrane or filter.
Referring to the chapter, given terms are defined.
Want to see more full solutions like this?
Chapter 10 Solutions
Genetic Analysis: An Integrated Approach (2nd Edition)
- The right-hand column contains descriptions of 5 types of molecular markers. Label each description with the name of the being described. Single-nucleotide polymorphism (SNP) Sequence-tagged site (STS) Microsatellite Amplified restriction fragment length polymorphism (AFLP) Restriction fragment length polymorphism (RFLP) Reset Zoom TABLE 23.1 Common Types of Molecular Markers Marker Description A site in a genome where the distance between two restriction sites varies among different individuals. These sites are identified by restriction enzyme digestion of chromosomal DNA and the use of Southern blotting. Amplified restriction fragment length polymorphism (AFLP) The same as an RFLP except that the site is amplified via PCR instead of isolating the chromosomal DNA. A site in the genome that contains many short sequences that are repeated many times in a row. The total length is usually in the range of 50-200 bp, and the length of a given microsatellite may be polymorphic within a…arrow_forwardA Western blot is seen in the picture above. Sodium dodecyl sulfate gel polyacrylamide gel electrophoresis was used to isolate the proteins (SDS-PAGE).1. Since gel electrophoresis has isolated individual proteins, what kind of molecule is used to detect them? 2. On the right side of this Western blot, three molecules are identified. One of the bands corresponds to the smallest molecule?arrow_forwardPlease place the stages of a CRISPR-cas9 gene editing workflow in the correct order below. Note, there is one incorrect and state why? Sequence Select for correctly gene edited cells (using antibiotic resistance and/or colour production for example) Clonal isolation Synthesise DNA insert oligonucleotides Clonal characterisation (analysis of phenotype) Add green fluorescent protein gene sequence into plasmid to aid selection of correctly transfected cells. Transfect cells Clone into CRISPR-cas9 expression vector Purify plasmids Design a set of targeting sequences using algorithms.arrow_forward
- Analyzing Cloned Sequences A base change (A to T) is the mutational event that created the mutant sickle cell anemia allele of beta globin. This mutation destroys an MstII restriction site normally present in the beta globin gene. This difference between the normal allele and the mutant allele can be detected with Southern blotting. Using a labeled beta globin gene as a probe, what differences would you expect to see for a Southern blot of the normal beta globin gene and the mutant sickle cell gene?arrow_forwardChoose two genes from Figure 4.6 and draw a graph to represent the change in transcription over time.arrow_forwardDNA samples from four individuals were cleaved with the same MW restriction endonuclease. The DNA fragments were separated by gel clectrophoresis, transferred to a membrane, and hybridized with a 12 kb 10 kb DNA probe complementary to a region between sites C and D (see 8 kb hybridization line). The image of the southern blot shows the labeled DNA bands and 6 kb molecular weight (MW) markers. The lane labels I, II, III, and IV -5 kb correspond to individuals I, II, III, and IV. Assume that fragments such as C-D and C-E are clearly resolved in this gel system. Fragment sizes are as given: A-B is 4 kb, B-C is I kb, C-D is 5 kb, and D-E is 650 bp. Individual I has five cleavage sites (A, B, C, D, and E) for the restriction endonuclease. DNA homologous to probe Which individual has at least one point mutation that eliminates restriction site C only? O II IV cannot be determined II Which individual has at least one point mutation that climinates restriction sites B and C? III O IV cannot be…arrow_forward
- Below is a western blot showing PCSK9 amount in livers of different mice (lanes 1-4) with mice genotypes shown at the bottom of each lane and PCSK9 band shown with an arrow. Molecular weight standards are found at the rightmost lane in kDa. (LDLR: LDL receptor) PCSK9 levels have been manipulated with CRISPR-Cas9 technology in mice in lanes 1, 2 and 4. Lane 3 is wild type mouse with no manipulation. Answer the questions 17-19 according to this schematic, which can also be found at this link. WESTERN BLOT kDa 148 1 2 3 4 98 64 PCSK9 52 45 36 22 Genotype: Which mouse has higher blood cholesterol between mice in lanes 1 and 2? [Select] Which mouse hat higher blood cholesterol between mice in lanes 3 and 4? [Select] LDLR (-/-) LDLR (+/+) LDLR (+/+) LDLR (+/+)arrow_forwardPrimers designing for epitope tagging: Design forward and reverse primers to amplify the following gene with 6×HIS-tag on the N-terminus of the protein. To be cleaved and inserted into the plasmid, add restriction sites for EcoRI and HindIII at 5' and 3'. ATGCTCTCCGCCCTCGCCCGGCCTGTCAGCGCTGCTCTCCGCCGCAGCTTCAGCACCTCAGCC CAGAACAATGCTAAAGTAGCTGTGCTAGGGGCCTCTGGAGGCATCGGGCAGCCACTTTCAC TTCTCCTGAAGAACAGCCCCTTGGTGAGCCGCCTGACCCTCTATGATATCGCGCACACACCC GGAGTGGCCGCAGATCTGAGCCACATCGAGACCAAAGCCGCTGTGAAAGGCTACCTCGGAC CTGAACAGCTGCCTGACTGCCTGAAAGGTTGTGATGTGTAAarrow_forwardLabel the following parts of the CRISPR-Cas 9 system. C A B C D Target DNA strand PAM sequence Cas9 protein Single-guide RNAarrow_forward
- A cloning vector map is shown below. EcoRI Bam Ban Hind P-galactosidase Amp Bam Bam EcoRI Ori C Which restriction site is best for inserting a DNA fragment for selection of chimeric plasmid containing colonies? 1) They're all equally good. 2) Hindll 3) EcoRI 4) BamHIarrow_forwardWhat are the major components of the CRISPR-Cas9 system? What mechanism does it employ to combine DNA? Explain the process of how the CRISP-Cas9 system is able to create recombinant DNA. Relate the idea of gene modification to the fields of vaccines and applied microbiology as well.arrow_forwardIn Western Blots and ELISAS, the following molecules are used: Tween-20 SDS Goat anti-rabbit IgG (whole molecule) – HRP Rabbit anti-egg albumin Bovine IgG Rabbit anti-bovine IgG – HRP Egg albumin (globular protein – what is Molecular weight?) Milk protein (globular protein – what is Molecular weight?) TMB Beta-mercaptoethanol Methanol HCl May you explain the reasons why they are used?arrow_forward
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning