Campbell Essential Biology (7th Edition)
7th Edition
ISBN: 9780134765037
Author: Eric J. Simon, Jean L. Dickey, Jane B. Reece
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 10, Problem 14IMT
Genes carry the instructions needed to build an RNA and then a protein.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
list all the steps required for mRNA to be translated into a protein
Which statement is false:
A) Each type of protein ( ex: hemoglobin vs trypsionngen) varies in the length and amino acid sequence of its peptide
B) After the rpocess of transcription is complete, the mRNA that is produced will continue being tranlsated by ribosomes for the rest of the cells life. mRNA never breaks down
C) A ribosome will bind to an mRNA and will translate the sequence by reading one codon at a time and adding one amino acid to the peptide chain. It will stop the translation once it encounters a stop codon
D) The gene for a protein provides the information on the legth of the peptide, along w the amino acid sequence so the protein can be synthesized by a ribosome
E) Once mRNA has left the nucleus, ribosomes will bind to it and will follow the instructions in its sequence to make the new protien
According to the Central Dogma, genes are the blueprints for making proteins. Each gene (humans have 21,325) contains a single “coded message” of DNA bases (A, T, G, & C) attached in a specific order, which the cell “reads” to create an mRNA molecule that is then translated into protein. Knowing this, EXPLAIN how a SINGLE gene can make different proteins in different cells.
Chapter 10 Solutions
Campbell Essential Biology (7th Edition)
Ch. 10 - A molecule of DNA contains two polymer strands...Ch. 10 - Name the three parts of every nucleotide.Ch. 10 - List these terms in order of size from largest to...Ch. 10 - A scientist inserts a radioactively labeled DNA...Ch. 10 - The nucleotide sequence of a DNA codon is GTA....Ch. 10 - Describe the process by which the information is a...Ch. 10 - Match the following molecules with the cellular...Ch. 10 - Prob. 8SQCh. 10 - Prob. 9SQCh. 10 - How do some viruses reproduce without ever having...
Ch. 10 - HIV requires an enzyme called _____ to convert its...Ch. 10 - Nearly every organism on Earth shares the...Ch. 10 - Prob. 13IMTCh. 10 - Genes carry the instructions needed to build an...Ch. 10 - A cell containing a single chromosome is placed in...Ch. 10 - In a classic 1952 experiment, biologists Alfred...Ch. 10 - Interpreting Data The graph shows the number of...Ch. 10 - Scientists at the National Institutes of Health...Ch. 10 - Prob. 19BSCh. 10 - Flu vaccines have been shown to be safe, are very...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that would be transcribed from the bottom strand of the DNA:arrow_forwardHow would you choose where to begin your reading of a sequence in mRNA? Which rule governing the use of the genetic code did you use?arrow_forwardDefine and identify the words listed below: CRISPR, codon, anti-codon, transcriptionarrow_forward
- Write a sentence describing the role of each of the following types of RNA in gene expression. mRNA- rRNA- tRNA- snRNA-arrow_forwardCan you spell your name (or someone else's) using the one-letter amino acid abbreviations? If so, construct an mRNA sequence that encodes your "protein" name.arrow_forwardThe following double stranded segment of DNA is part of a protein coding gene. The segments in uppercase letters (ACTG) represent the exons. The segments in lowercase letters (acgt) represent introns. The lower strand is the template strand that is used by the RNA polymerase to make an RNA transcript. Draw or write-out a) the sequence of the primary transcript and b) the mature mRNA resulting from this stretch of DNA.arrow_forward
- Describe the process by which the information in eukaryotic gene is transcribed and translated into a protein. Correctly use this words in your description: tRNA, amino acid, start codon, RNA polymerase, ribosome, translation, anticodon, peptide bond, stop codonarrow_forwardThe Human Genome Project showed that human DNA is not considerably bigger than much simpler organisms, with about 30,000 total genes. However, humans make over 100, 000 different proteins. How is this possible? (Hint: think about splicing.)arrow_forwardThe "TATA box" is a [DNA, RNA, Carbohydrate, protein] sequence known as a [promoter, start codon, n-terminus, 5' end] that signals areas where [translation, transcription, replication, protein sequencing] should begin.arrow_forward
- Describe the roles of RNA molecules in gene expression.arrow_forwardRefer to the genetic code in Figure 15.10 to answer the following question Q. If a single transversion occurs in a codon that specifies Leu, what amino acids can be specified by the mutated sequence?arrow_forwardHydrogen bonds are important in DNA replication and transcription. They are relatively weak chemical bonds. Why is this a desirable feature for DNA? Describe the effect (s) of changing (mutating) the promoter on the transcription of the DNA strand/gene the promoter controls. What happens to protein synthesis if a nonsense codon is inserted into the gene? Explain why a point mutation does not necessarily change the original amino acid sequence. (Explain silent mutations) Choose any pentapeptide composed of five different amino acids. List the amino acids. Present one messenger RNA codon for each amino acids and the sequence of nucleotides on the DNA that originally coded for your pentapeptide.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license