Campbell Essential Biology (7th Edition)
7th Edition
ISBN: 9780134765037
Author: Eric J. Simon, Jean L. Dickey, Jane B. Reece
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 10, Problem 14IMT
Genes carry the instructions needed to build an RNA and then a protein.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Several different nucleic acids are involved
in the process of getting a protein
produced from a gene. DNA contains the
"genetic code" for the protein. DNA is
double-stranded, but only one strand is
transcribed into MRNA. The MRNA then
goes into the cytoplasm where it is
translated into protein with the help of
TRNA. At each stage of the process, there is
base complementarity (A pairs with T/U
and C pairs with G) between the nucleic
acids involved to ensure the integrity of
the DNA blueprint for the protein being
produced. Therefore, some of the four
strands of nucleic acids involved will
match (except U replaces T in RNA) and
some will have base complementarity.
Indicate whether there is matching (1) or
base complementarity (2) between the
following nucleic acids.
DNA sense strand and MRNA
DNA sense strand and tRNA
DNA antisense strand and
MRNA
MRNA and TRNA
list all the steps required for mRNA to be translated into a protein
Which statement is false:
A) Each type of protein ( ex: hemoglobin vs trypsionngen) varies in the length and amino acid sequence of its peptide
B) After the rpocess of transcription is complete, the mRNA that is produced will continue being tranlsated by ribosomes for the rest of the cells life. mRNA never breaks down
C) A ribosome will bind to an mRNA and will translate the sequence by reading one codon at a time and adding one amino acid to the peptide chain. It will stop the translation once it encounters a stop codon
D) The gene for a protein provides the information on the legth of the peptide, along w the amino acid sequence so the protein can be synthesized by a ribosome
E) Once mRNA has left the nucleus, ribosomes will bind to it and will follow the instructions in its sequence to make the new protien
Chapter 10 Solutions
Campbell Essential Biology (7th Edition)
Ch. 10 - A molecule of DNA contains two polymer strands...Ch. 10 - Name the three parts of every nucleotide.Ch. 10 - List these terms in order of size from largest to...Ch. 10 - A scientist inserts a radioactively labeled DNA...Ch. 10 - The nucleotide sequence of a DNA codon is GTA....Ch. 10 - Describe the process by which the information is a...Ch. 10 - Match the following molecules with the cellular...Ch. 10 - Prob. 8SQCh. 10 - Prob. 9SQCh. 10 - How do some viruses reproduce without ever having...
Ch. 10 - HIV requires an enzyme called _____ to convert its...Ch. 10 - Nearly every organism on Earth shares the...Ch. 10 - Prob. 13IMTCh. 10 - Genes carry the instructions needed to build an...Ch. 10 - A cell containing a single chromosome is placed in...Ch. 10 - In a classic 1952 experiment, biologists Alfred...Ch. 10 - Interpreting Data The graph shows the number of...Ch. 10 - Scientists at the National Institutes of Health...Ch. 10 - Prob. 19BSCh. 10 - Flu vaccines have been shown to be safe, are very...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Describe how protein are created in translation. Step by steparrow_forwardDefine and identify the words listed below: CRISPR, codon, anti-codon, transcriptionarrow_forwardWhich of the following is an example of the degeneracy of the genetic code?Group of answer choices a) each codon specifies more than one amino acid b) the genetic code is not degenerate c) an amino acid can have more than one codon d) None of the abovearrow_forward
- How would you choose where to begin your reading of a sequence in mRNA? Which rule governing the use of the genetic code did you use?arrow_forwardRefer to Figure 9.7, then translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the first base: 5′—UGUCAUGCUCGUCUUGAAUCUUGUGAUGCUCGUUGGAUUAAUUGU—3′arrow_forwardExplain what it means to say that the genetic code is redundant and unambiguous?arrow_forward
- Write a sentence describing the role of each of the following types of RNA in gene expression. mRNA- rRNA- tRNA- snRNA-arrow_forwardDiscuss the following statement: “from the nucleotide sequence of a cDNA clone, the complete amino acid sequence of a protein can be deduced by applying the genetic code. thus, protein biochemistry has become superfluous because there is nothing more that can be learned by studying the protein.”arrow_forwardCan you spell your name (or someone else's) using the one-letter amino acid abbreviations? If so, construct an mRNA sequence that encodes your "protein" name.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license