Directions: Transcribe the following strand into mRNA, then translate it into amino acids. Use scratch paper to document your findings. Example DNA TAC-AAA-AAC-AAG-GTA-ACG-GTC-ATC mRNA AUG-UUU-UUG-UUC-CAU-UGC-CAG-UAG AA Start-Phe-Leu- Phe-His-Cys-Gln-Stop DNA mRNA AA TAC-CGA-CGC-CGG-CGT-ATC GCG :: GCC :: Stop : GCA :: Methionine (Start) :: Serine :: Leucine :: Alanine :: AUG :: UAG :: Phenylalanine :: Tyrosine GCU Glycine :: Proline

Q: Which of the following is not a term used to describe an unspliced mRNA? intronic mRNA O primary…

A: In eukaryotic genes, non coding DNA is also present. In most of the eukaryotic genes, coding…

Q: Explain the term polycistronic mRNA.

A: An m RNA that can encode for many proteins is known as polycistronic m RNA.. This m RNA is present…

Q: Draw a typical bacterial mRNA and the gene from which it was transcribed. Identify the 5′ and 3′…

A: DNA is the main constituent of the chromosome. It contains all information about protein that forms…

Q: Which, if any, of the following sequences cannot exist for a mRNA. Explain your answer. UUUUUU…

A: Instructions for construction of proteins is done in 2 steps- transcription and translation.…

Q: If a scientist synthesizes a DNA molecule with a nucleotide base sequence to TACGGGGGAGGGGGAGGGGGA…

A: There are 4 nitrogen bases present in DNA, these are Adenine, Thymine, Cytosine, and Guanine.…

Q: Describe all the elements required to carry out the process of translation.

A: What is translation Translation refers  to the process of polymerization of amino acids to form a…

Q: In the process of translation, the input is and the output is O TRNA, MRNA O MRNA, protein O DNA,…

A: Translation is a process in which protein is synthesized from the information contained in a…

Q: How would you choose where to begin your reading of a sequence in mRNA?  Which rule governing the…

A: The translation is the process by which polypeptide chain (protein) is produced from the mRNA…

Q: If a eukaryotic MRNA lacked a poly-A tail, where would the MRNA be located? Select an answer and…

A: Transcription is a process through which the template strand of DNA gets transcribed into mRNA. In…

Q: Bacteria Eukaryotes First amino acid 5' end 3' end Cistron Introns/exons

A: Bacterial and eukaryotic m-RNA is different from each other in bacterial translation first amino…

Q: List the 4 types of RNA degradation and describe each in 1 sentence

A: RNA degradation is the process by which ribonucleic acid molecules are enzymatically degraded. It is…

Q: Describe in detail the steps of translation termination in bacteria. Explain what happe

A: For the synthesis of a polypeptide with a defined sequence, two fundamental chemical requirements…

Q: Compare and contrast bacterial and eukaryotic translation.

A: The central dogma of biology explains the flow of information from genes to protein by two…

Q: Examine the events that occur during the three majorsteps of translation.

A: Translation is the one step after transcription. It is the process of converting mRNA into a…

Q: The sequence: ATTGCCGACGACTTG is complementary to a sequence that is used as a template in…

A: (-) Sense

Q: If the sequence of the coding strand in a transcription unit is written as follows: 5'-…

A: In that question we have to write down the sequence of mRNA.

Q: Explain the elongation steps in bacterial translation

A: The translation is defined as the conversion of mRNA into proteins. The nucleotides in the group of…

Q: n the process of transcription, the input is and the output is O tRNA, DNA O MRNA, protein O DNA,…

A: the central dogma of molecular biology suggest that biological information flows from DNA to RNA to…

Q: Pick the most complete list of mRNA sequences that translate into Ser.   Question 3 options:…

A: According to the question, we have to find out the option which is the most complete list of mRNA…

Q: Define translation process?

A: All the living cells are made up of protein, which acts as building blocks for every organism. These…

Q: Outline the three stages of translation.

A: The process of synthesis proteins from ribosomes in cytoplasm or endoplasmic reticulum is defined as…

Q: what enzyme is needed to make mrna

A:

Q: Describe a technique you would use to identify the location of mRNA in an organism.

A: ANS: Microarray analysis enables researchers to look at expression patterns across all of the genes…

Q: of mRNA that contains a total of 66 codons. What is the maximum number of amino acids that could be…

A: The formation of mRNA from DNA is called transcription and from mRNA to a protein called…

Q: create a summary of the nucleotide pairs during the translation process

A: Answer: Introduction: Translation process occurs in ribosomes of cytosol or membrane of the…

Q: An mRNA has the following base sequence:5′–CAGGCGGCGAUGGACAAUAAAGCGGGCCUGUAAGC–3′Identify the start…

A: Hereditary qualities are a piece of science stressed over the examination of qualities, hereditary…

Q: Define and identify the words listed below: CRISPR, codon, anti-codon, transcription

A: Definition:  CRISPR:                  A segment of DNA compiled of short repetitions of base…

Q: Draw a typical bacterial mRNA and the gene from which it was transcribed. Identify the 5′ and 3′…

A: The DNA (deoxyribonucleic acid) is the genetic material that is transcribed into ribonucleic acid…

Q: A scientist sequencing mRNA identifies the following strand:…

A: mRNA is termed as messenger RNA. It is a single stranded RNA used in the synthesis of protein.mRNA…

Q: Transcribe the following DNA strand into a MRNA strand. TAC a AUG ATG TAC DIY

A: Transcription is the process by which DNA code of a gene into mRNA code.

Q: Describe what happens to the transcribed mRNA before it can leave the nucleus and be used for…

A: Introduction Messenger RNA (mRNA):- It is a type of single-stranded RNA involved in protein…

Q: Draw a typical bacterial mRNA and the gene from which it was transcribed. Identify the 5′ and 3′…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: Draw a typical bacterial mRNA and the gene from which it was transcribed. Identify the 5′ and 3′…

A: Answer: Figure: Transcription start site and mRNA containing 5* and 3* ends.

Q: Use the DNA sequence above, list all possible splicing products

A: Splicing, is a form of RNA processing in which a pre- mRNA transcript is transformed into a mRNA.…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.