Directions: Transcribe the following strand into mRNA, then translate it into amino acids. Use scratch paper to document your findings. Example DNA TAC-AAA-AAC-AAG-GTA-ACG-GTC-ATC mRNA AUG-UUU-UUG-UUC-CAU-UGC-CAG-UAG AA Start-Phe-Leu- Phe-His-Cys-Gln-Stop DNA mRNA AA TAC-CGA-CGC-CGG-CGT-ATC GCG :: GCC :: Stop : GCA :: Methionine (Start) :: Serine :: Leucine :: Alanine :: AUG :: UAG :: Phenylalanine :: Tyrosine GCU Glycine :: Proline

Q: In the following table, below each DNA nucleotide, type in the complementary mRNA nucleotides. Then,…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: What would be the mRNA strand if the DNA strand reads: TACCGAGTCACG?

A: Transcription and translation are processes that a cell employs to create all of the proteins…

Q: Explain the term polycistronic mRNA.

A: An m RNA that can encode for many proteins is known as polycistronic m RNA.. This m RNA is present…

Q: Draw a typical bacterial mRNA and the gene from which it was transcribed. Identify the 5′ and 3′…

A: DNA is the main constituent of the chromosome. It contains all information about protein that forms…

Q: If a scientist synthesizes a DNA molecule with a nucleotide base sequence to TACGGGGGAGGGGGAGGGGGA…

A: There are 4 nitrogen bases present in DNA, these are Adenine, Thymine, Cytosine, and Guanine.…

Q: Describe all the elements required to carry out the process of translation.

A: What is translation Translation refers  to the process of polymerization of amino acids to form a…

Q: Name and describe in DETAIL the three steps of translation.

A: Polymerization of amino acids to generate a chain of polypeptides is known as translation.…

Q: In the process of translation, the input is and the output is O TRNA, MRNA O MRNA, protein O DNA,…

A: Translation is a process in which protein is synthesized from the information contained in a…

Q: In the diagram below, identify the mRNA by clicking on the correct highlighted portion. TACGGGCTA A…

A: Alleles are considered as the variant of the gene. DNA is composed of different nucleotides that…

Q: Explain the process translation. A complete answer will include the words below tRNA, amino acid,…

A: The translation is the process of amino acid change of protein synthesis from the mRNA sequence. The…

Q: How would you choose where to begin your reading of a sequence in mRNA?  Which rule governing the…

A: The translation is the process by which polypeptide chain (protein) is produced from the mRNA…

Q: If a eukaryotic MRNA lacked a poly-A tail, where would the MRNA be located? Select an answer and…

A: Transcription is a process through which the template strand of DNA gets transcribed into mRNA. In…

Q: Bacteria Eukaryotes First amino acid 5' end 3' end Cistron Introns/exons

A: Bacterial and eukaryotic m-RNA is different from each other in bacterial translation first amino…

Q: List the 4 types of RNA degradation and describe each in 1 sentence

A: RNA degradation is the process by which ribonucleic acid molecules are enzymatically degraded. It is…

Q: Interpret this mRNA strand and determine the proper sequence and shape of this protein:  AUG UCA CGC…

A: Introduction :- When transcription occurs, mRNA is produced. RNA polymerase decodes a single strand…

Q: All of the following participate in the process of translation except:     ribosomes mRNA tRNA 35S…

A: Translation  It is defined as the process of production of proteins from the mRNA transcript. In…

Q: What is the tRNA strand for the following mRNA strand: CAGGAUGAAUUGCUC

A: To determine the tRNA (transfer RNA) sequence corresponding to the given mRNA (messenger RNA)…

Q: Compare and contrast bacterial and eukaryotic translation.

A: The central dogma of biology explains the flow of information from genes to protein by two…

Q: What is the name of the enzyme is responsible for transcribing the DNA sequence into mRNA? In your…

A: Trascription is the process by which the information on DNA is transferred to a molecule of RNA.…

Q: Transcribe and translate the following DNA sequence (nontemplate strand);…

A: The gene is expressed into protein by the transcription and translation step.

Q: Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU…

A: The process of producing protein by association of mRNA and ribosomes is called translation. The…

Q: Give some points about the flow of information during translation?

A: Translation is the process of protein synthesis from mRNA (Messenger ribonucleic acid) with the help…

Q: Examine the events that occur during the three majorsteps of translation.

A: Translation is the one step after transcription. It is the process of converting mRNA into a…

Q: The sequence: ATTGCCGACGACTTG is complementary to a sequence that is used as a template in…

A: (-) Sense

Q: If the sequence of the coding strand in a transcription unit is written as follows: 5'-…

A: In that question we have to write down the sequence of mRNA.

Q: n the process of transcription, the input is and the output is O tRNA, DNA O MRNA, protein O DNA,…

A: the central dogma of molecular biology suggest that biological information flows from DNA to RNA to…

Q: Pick the most complete list of mRNA sequences that translate into Ser.   Question 3 options:…

A: According to the question, we have to find out the option which is the most complete list of mRNA…

Q: Explain the process of translation.

A: mRNA is used to synthesise proteins during the translation process, which occurs during the process…

Q: During initiation of translation, what protein is attached to the mRNA?     Initiation factors…

A: Translation is the process by which the genetic information encoded in messenger RNA (mRNA) is used…

Q: Define translation process?

A: All the living cells are made up of protein, which acts as building blocks for every organism. These…

Q: Outline the three stages of translation.

A: The process of synthesis proteins from ribosomes in cytoplasm or endoplasmic reticulum is defined as…

Q: Describe a technique you would use to identify the location of mRNA in an organism.

A: ANS: Microarray analysis enables researchers to look at expression patterns across all of the genes…

Q: Give the initiation codon for protein synthesis. Name the amino acid it codes for?

A: A genetic codon is a three-nucleotide sequence of either DNA or RNA that corresponds to a particular…

Q: Name and explain the process by which mRNA is formed.

A: Gene expression is the process by which information which is contained in genes is decoded to…

Q: Describe protein biosynthesis. Define transcription and translation. What enzyme…

A: The cell biology is considered as the study of cells, their structure, and their functions. The…

Q: An mRNA has the following base sequence:5′–CAGGCGGCGAUGGACAAUAAAGCGGGCCUGUAAGC–3′Identify the start…

A: Hereditary qualities are a piece of science stressed over the examination of qualities, hereditary…

Q: Describe the roles of RNA polymerase, ribosomes, andtRNA in producing a protein.

A: Ribonucleic acid (RNA) aids in the production of proteins in the body and is normally obtained from…

Q: If a eukaryotic MRNA lacked a poly-A tail, where would the MRNA be located? Cytoplasm Endoplasmic…

A: The stability of mRNAs varies considerably in the case of eukaryotic organisms. Some mRNAs have very…

Q: Define and identify the words listed below: CRISPR, codon, anti-codon, transcription

A: Definition:  CRISPR:                  A segment of DNA compiled of short repetitions of base…

Q: How many bases would a mRNA have? if it was coded for a protein of 250 amino acids long? explain…

A: The flow of genetic information in a biological system is explained by central dogma and it involves…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.