Human Anatomy & Physiology (11th Edition)
Human Anatomy & Physiology (11th Edition)
11th Edition
ISBN: 9780134580999
Author: Elaine N. Marieb, Katja N. Hoehn
Publisher: PEARSON
Bartleby Related Questions Icon

Related questions

Q: In the following table, below each DNA nucleotide, type in the complementary mRNA nucleotides. Then,…
A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…
Q: What would be the mRNA strand if the DNA strand reads: TACCGAGTCACG?
A: Transcription and translation are processes that a cell employs to create all of the proteins…
Q: Explain the term polycistronic mRNA.
A: An m RNA that can encode for many proteins is known as polycistronic m RNA.. This m RNA is present…
Q: Draw a typical bacterial mRNA and the gene from which it was transcribed. Identify the 5′ and 3′…
A: DNA is the main constituent of the chromosome. It contains all information about protein that forms…
Q: If a scientist synthesizes a DNA molecule with a nucleotide base sequence to TACGGGGGAGGGGGAGGGGGA…
A: There are 4 nitrogen bases present in DNA, these are Adenine, Thymine, Cytosine, and Guanine.…
Q: Describe all the elements required to carry out the process of translation.
A: What is translation Translation refers  to the process of polymerization of amino acids to form a…
Q: Name and describe in DETAIL the three steps of translation.
A: Polymerization of amino acids to generate a chain of polypeptides is known as translation.…
Q: In the process of translation, the input is and the output is O TRNA, MRNA O MRNA, protein O DNA,…
A: Translation is a process in which protein is synthesized from the information contained in a…
Q: In the diagram below, identify the mRNA by clicking on the correct highlighted portion. TACGGGCTA A…
A: Alleles are considered as the variant of the gene. DNA is composed of different nucleotides that…
Q: How would you choose where to begin your reading of a sequence in mRNA?  Which rule governing the…
A: The translation is the process by which polypeptide chain (protein) is produced from the mRNA…
Q: If a eukaryotic MRNA lacked a poly-A tail, where would the MRNA be located? Select an answer and…
A: Transcription is a process through which the template strand of DNA gets transcribed into mRNA. In…
Q: List the 4 types of RNA degradation and describe each in 1 sentence
A: RNA degradation is the process by which ribonucleic acid molecules are enzymatically degraded. It is…
Q: Interpret this mRNA strand and determine the proper sequence and shape of this protein:  AUG UCA CGC…
A: Introduction :- When transcription occurs, mRNA is produced. RNA polymerase decodes a single strand…
Q: All of the following participate in the process of translation except:     ribosomes mRNA tRNA 35S…
A: Translation  It is defined as the process of production of proteins from the mRNA transcript. In…
Q: What is the tRNA strand for the following mRNA strand: CAGGAUGAAUUGCUC
A: To determine the tRNA (transfer RNA) sequence corresponding to the given mRNA (messenger RNA)…
Q: What is the name of the enzyme is responsible for transcribing the DNA sequence into mRNA? In your…
A: Trascription is the process by which the information on DNA is transferred to a molecule of RNA.…
Q: Transcribe and translate the following DNA sequence (nontemplate strand);…
A: The gene is expressed into protein by the transcription and translation step.
Q: Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU…
A: The process of producing protein by association of mRNA and ribosomes is called translation. The…
Q: Give some points about the flow of information during translation?
A: Translation is the process of protein synthesis from mRNA (Messenger ribonucleic acid) with the help…
Q: The sequence: ATTGCCGACGACTTG is complementary to a sequence that is used as a template in…
A: (-) Sense
Q: n the process of transcription, the input is and the output is O tRNA, DNA O MRNA, protein O DNA,…
A: the central dogma of molecular biology suggest that biological information flows from DNA to RNA to…
Q: Pick the most complete list of mRNA sequences that translate into Ser.   Question 3 options:…
A: According to the question, we have to find out the option which is the most complete list of mRNA…
Q: During initiation of translation, what protein is attached to the mRNA?     Initiation factors…
A: Translation is the process by which the genetic information encoded in messenger RNA (mRNA) is used…
Q: Describe a technique you would use to identify the location of mRNA in an organism.
A: ANS: Microarray analysis enables researchers to look at expression patterns across all of the genes…
Q: Describe protein biosynthesis. Define transcription and translation. What enzyme…
A: The cell biology is considered as the study of cells, their structure, and their functions. The…
Q: An mRNA has the following base sequence:5′–CAGGCGGCGAUGGACAAUAAAGCGGGCCUGUAAGC–3′Identify the start…
A: Hereditary qualities are a piece of science stressed over the examination of qualities, hereditary…
Q: If a eukaryotic MRNA lacked a poly-A tail, where would the MRNA be located? Cytoplasm Endoplasmic…
A: The stability of mRNAs varies considerably in the case of eukaryotic organisms. Some mRNAs have very…
Q: Define and identify the words listed below: CRISPR, codon, anti-codon, transcription
A: Definition:  CRISPR:                  A segment of DNA compiled of short repetitions of base…
Q: How many bases would a mRNA have? if it was coded for a protein of 250 amino acids long? explain…
A: The flow of genetic information in a biological system is explained by central dogma and it involves…
bartleby

Concept explainers

Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of anoth…
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
Topic Video
Question

Transcribe the following strand in Mrna, then translate it into amino acids

Directions: Transcribe the following strand into mRNA, then translate it into amino acids. Use scratch paper to document your findings. Example DNA TAC-AAA-AAC-AAG-GTA-ACG-GTC-ATC mRNA AUG-UUU-UUG-UUC-CAU-UGC-CAG-UAG AA Start-Phe-Leu- Phe-His-Cys-Gln-Stop DNA mRNA AA TAC-CGA-CGC-CGG-CGT-ATC GCG :: GCC :: Stop :: Methionine (Start) :: Leucine :: Alanine :: AUG :: GCU :: Glycine :: GCA :: Serine :: UAG :: Phenylalanine :: Tyrosine :: Proline
expand button
Transcribed Image Text:Directions: Transcribe the following strand into mRNA, then translate it into amino acids. Use scratch paper to document your findings. Example DNA TAC-AAA-AAC-AAG-GTA-ACG-GTC-ATC mRNA AUG-UUU-UUG-UUC-CAU-UGC-CAG-UAG AA Start-Phe-Leu- Phe-His-Cys-Gln-Stop DNA mRNA AA TAC-CGA-CGC-CGG-CGT-ATC GCG :: GCC :: Stop :: Methionine (Start) :: Leucine :: Alanine :: AUG :: GCU :: Glycine :: GCA :: Serine :: UAG :: Phenylalanine :: Tyrosine :: Proline
Expert Solution
Check Mark
This question has been solved!
Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.
bartleby
This is a popular solution
See solutionCheck out a sample Q&A here
Step 1: Introduction
VIEW
Step 2: Transcription and translation
VIEW
Solution
VIEW
bartleby

Trending nowThis is a popular solution!

bartleby

Step by stepSolved in 3 steps

See solution
Check out a sample Q&A here
Blurred answer
Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Text book image
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Text book image
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Text book image
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Text book image
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Text book image
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
SEE MORE TEXTBOOKS