Which of the following units recognize UAG, UAA, and UGA codons? (Single answer) Elongation factors Termination factors RNA synthase DNA polymerase RNA polymerase
Q: 1. Draw the structure of the following fatty acids: (a) Stearic acid (b) Arachidonic acid 2. Draw…
A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…
Q: Explain substrate cycling in glycolysis in relation to gluconeogesis
A: Substrate cycle is referred to as set of Metabolic reactions that occur in a cyclic or opposite…
Q: 10. Certain molecules in the muscular system must be maintained in a homeostatic range for the…
A: Muscular system maintains homeostasis by movement, support and heat production. There are certain…
Q: The following peptide is cut by serine protease enzyme Trypsin. How many fragments will be produced…
A: Proteases are enzymes which digest proteins by cleaving the peptide bonds. Trypsin is a protease…
Q: What glycolytic intermediate is fructose converted to in the muscle, such that it can be utilized in…
A: Fructose is an abundant dietary monosaccharide that is present naturally in fruits and vegetables…
Q: Authophagy refers to naturally regulated mechanisms of degradation and removal of dysfunctional…
A: Denaturation is the phenomenon through which proteins or nucleic acids loses their native…
Q: Paul and his friends ate at a fast-food restaurant. Paul, who has a mass of 70 kg, had a…
A: MET or Metabolic Equivalent of Task is defined at the ration of the rate at which an individual…
Q: Choose the correct option as the degree of unsaturation in a fatty acid increase Fluidity increases…
A: Fatty acids are classified into saturated and unsaturated based on the presence of double bonds.…
Q: S/what is the difference between SPM and AFM² // what is polymerase chain reaction (PCR) ? Show…
A: Introduction: The polymerase chain reaction was developed by Karry Mullis in the year 1983. It is…
Q: Quest: 2 Alleppt any Two a write a note on oxidative phosphorylation 1 Describe induced fit theory…
A: Enzymes are protein molecules that take part in speeding up biological reactions. Biological…
Q: Choose rich-energy molecules: Adenin ATP Glucose Phosphoenolpyruvate
A: Energy-rich molecules are those that provide energy after their degradation into other small…
Q: What secondary structural elements are most likely present in this sequence? Please annotate the…
A: Proteins are polymers of amino acids linked by peptide/amide bonds between the carboxyl group of one…
Q: In the 1800s, cocaine was being used: O only in South America O for surgical general anesthesia to…
A: Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: The doctor ordered Claforan 1400mg IM every 12 hours. The directions for the 2 gm vial state: Add…
A: The doctor ordered Claforan 1400mg IM every 12 hours. The directions for the 2 gm vial state: Add…
Q: What is the correct designation of this alkene? cis o trans
A: Cis alkene: The isomer in which the two groups attached to the carbons of the double bond (i.e.,…
Q: 10-7. A classic paper studied the behavior of lipids in the two monolayers of a membrane by labeling…
A: Lipid bilayer: It is a polar membrane made up of two layers of lipid molecules that is very thin.…
Q: The enzyme that involved in the catalysis from alpha-ketoglutarate to glutamate is A.…
A: The enzyme that involved in the catalysis from alpha-ketoglutarate to glutamate is.......
Q: If a person consume their average kcalorie intake per day over a month, assuming no change in…
A: A calorie is a unit of energy, just like a kilogram (kg) is a unit of weight and a kilometre (km) is…
Q: Which of the following statements about a plot of V0 vs. [S] for an enzyme that follows…
A: Michaelis-Menten kinetics equation Vo = Vmax[S]/(Km+[S]) Vo is reaction rate Vmax is maximum…
Q: What is ion-exchange chromatography based on? moving a molecule with a net charge in an electric…
A: Ion exchange means the exchange of ions with protein molecules. In chromatography, there is a…
Q: Choose the FALSE statement about protein electrophoresis. The proteins in the gel can be…
A: Electrophoresis is a process in which electric field is applied to separate macromolecules like…
Q: if glycogen is subjected directly to nelson's assay without prior hydrolysis
A: Nelson's assay method or Nelson-Somogyi method is used for the quantitative determination of…
Q: A protein was recently discovered to be located in the nucleus. However, it is uncertain whether…
A: The most important and basic knowledge that we should remember here in-order to understand the…
Q: Which of the following is true regarding microbial tests that lead to color change in tubes used to…
A: Option 1 and 4 are correct. There are multiple tests involving color change for bacteria…
Q: What is DRESS .Give full form of this syndrome.
A: It is a type of drug induced hypersensitivity reaction, caused by certain medication.
Q: Calculate the ATP yield from full oxidation of the fatty acids from a triglyceride with 3, 22 carbon…
A: Fatty acids are released in the digestion of triglycerides. These fatty acids undergo beta oxidation…
Q: When an inappropriate amino acid is substituted in place of another, as occurs in certain genetic…
A: Though proteins are made up of hundreds of amino acids but each amino acid is important in the…
Q: ATP levels are high in the liver, NADPH levels are low, but fat biosynthesis needs to happen. What…
A: The pentose phosphate pathway is also known as the hexose-mono-phosphate shunt pathway. It occurs in…
Q: The following has the lowest energy per gram when oxidized Carbohydrate protein ethanol O Lipids O
A: Introduction: Biomolecules are the macromolecules produced by the tissues of the organisms. They are…
Q: What is the total number of hydrogen bonds that exist between the DNA strand 5’-TTCAGAG-3’ and its…
A: Adenine and guanine are the purine bases which occur in the nucleic acids. And thymine, cytosine,…
Q: "Enzyme immobilization confers greater stability to the enzyme"-Do you agree or disagree with the…
A: Introduction: Enzymes are biological catalyst that fastens the rate of chemical reactions. It is…
Q: Draw the zwitterionic structure of asparagine. .
A: An ion with two functional groups is known as a zwitterion. It's an ion with both positive and…
Q: the maximum amount of ATP that could be generated by the full oxidation of the compound…
A: The given compound is a saturated fatty acid known as caproic acid. It has six carbon atoms and zero…
Q: insufficient protein in the blood plasma
A: Edema in kwashorikar is basically due to insufficient protein in blood plasma which is albumin…
Q: Vitamins that are necessary for the transfer of hydrogen atoms: CH3 CH3 N NH₂ 'N Но NH₂ SENH ОН МОН…
A: Vitamins are organic compounds that are required in the diet in small amounts. They perform various…
Q: Which of the following statements is true about the control of muscle glycogen phosphorylase? a) It…
A: Introduction: Glycogen phosphorylase is a key enzyme that takes part in the first step of…
Q: give the significance/role/effect of the reagent/condition in the isolation or analysis of a…
A: The classical method of lipid extraction from egg yolk is the 2-Propanol/Hexane solvent extraction…
Q: Question 5 (2 points) Which of the following decreases the affinity of hemoglobin for oxygen? Choo-…
A: There is a continuous relationship between the oxygen affinity of hemoglobin and oxygen saturation…
Q: One DNA chain of a DNA double helix contains 18% A, 35% T, 28% C and 21% G. What is the composition…
A: DNA is a genetic material present in most of living organism and it is composed of nucleotides.…
Q: give the significance/role/effect of the reagent/condition in the isolation or analysis of a…
A: DNA isolation is a process of isolation of DNA from biological sample like body fluid, tissue, etc.…
Q: Which of the following is true about the structure of nucleotides? A. Purine nucleotides cannot…
A: Thymine is supplanted by uracil in RNA (U). A, G, C, T, and U's chemical structures. Due to their…
Q: List reaction or pathways of fatty acid oxidation and biosynthesis affected by insulin and glucagon.
A: Insulin is the hormone synthesized by the β cells of pancreas. Whereas glucagon is synthesized by…
Q: Describe/define the five principal digestive juices (or fluids) that enter the digestive tract at…
A: Digestion is the process of breaking down food into its simpler forms, which is performed by various…
Q: toxin) njected, it paralyze locally. Based on this information only, what neurotransmitter system…
A: Botox (Botulinum toxin)is considered as a neurotoxin protein ,this toxin can lead to a condition…
Q: Chemistry help with c, d, e, and i.
A: In the citric acid cycle, the acetyl group of acetyl CoA molecule is completely oxidized. The citric…
Q: Information for Part 2 The following table shows the concentration of ATP, ADP and phosphate into…
A: In the above question the change in free energy can be calculated by Δ?′ = Δ?0 + ?? ln ([???][??]/…
Q: There are various types of DNA-targeting drug, including DNA alkylating agents, DNA intercalators…
A: Cancer cells are produced due to mutations in the cell's DNA, such as loss of function mutation of…
Q: In RNA OH group is present at 2' position True O
A: Nucleic Acid is a polymer of nucleotides. Nucleotide consist of nucleoside and phosphate group.…
Q: Which of the following is the best description of the composition of a triglyceride? O1 glycerol + 2…
A: Triglycerides are used to store fatty acids in the adipose tissue of humans. Triglycerides can be…
Q: Identify the compounds represented by the following letters: G, GMP, dGDP, CTP.
A: There are 4 types of Nitrogen bases that are found in DNA ; they are Adenine, Guanine, Cytosine and…
Step by step
Solved in 2 steps
- Use the genetic code table to determine the amino acid sequence of the given message strand of DNA below, from N to C terminal. All introns were removed in this sequence for simplicity. Write the amino acids in their 3-letter abbreviation and separate with a dash. Do not put a space in between characters so that LMS will recognize your answer. Message Strand +1 5-TAGTAGGCGGCATGTTTTCCCATACAGATGAAGGATAAACTCGTCT[x]TAT-3' [x]-cleavage site for CFI/CFII endonuclease (for RNA) Genetic Code: Second letter с A G UAUTyr UGC Cys UAC. UAA Stop UGA Stop UAG Stop UGG Trp CAUT CGU CAC His CGC CAA CGA Arg Gin CAGJ CGG AAU Asn AGU Ser AAC. AGC AAA AGA AAG Lys AGG Arg GAU GGU Asp GACJ GGC GAA GGA Glu GAGJ GGG] First letter כ A G U UUU UUC UUA UUGL CUU CUC CUA CUG AUU AUC lle AUA AUG Met GUU GUC Val GUA GUG Phe Leu Leu UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala Gly DUAU DUAU DURO DURO A G Third letterGiven the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?Which of these choices represents one possible corresponding mRNA sequence that can be transcribed from the following DNA template? 5′ - CTGTATCCTAGCACCCAAATCGCATTAGGAC - 3′
- Name of the enzyme that adds RNA Nucleotides during Transcription? O Helicase O Primase DNA Polymerase O RNA Polymerase 9MDTranslate the protein that is expressed from this template DNA sequence. Transcription is going left to right, the intron is underlined. Codon table is provided. 3' ATCATGACCTACAGGCAGATGATTATAGACCCTGACATTTATTTGGCG 5'The sequence below is a template strand sequence for a gene (a very short one!). Identify the start codon and the amino acid sequence of this gene. Write your answer in 3 letter amino acid code. Put a hyphen between each amino acid. You should also include a description of any working or steps you have taken to determine your answer. 5' AGTCAGCAAGAAGACATCAGTGTTCCCATCTGT 3' Paragraph V B I U A = 8⁰ + v 11.
- does anyone know how to list the RNA sequence transcribed from the DNA template sequence TTACACTTGCTTGAGAGTC.Original DNA Sequence: T A C G C A A A A A T C G A T C G A A C TmRNA Sequence:Amino Acid Sequence:Mutated DNA Sequence # 1: T A C G C A A A A A T T G A T C G A A C TmRNA Sequence:Amino Acid Sequence:Will there likely be any effects from the mutation? yes or no. Explanation: _________________________________ ______________________________________________________________________________________________What type of mutation is it? _________________________________________________________________Mutated DNA Sequence # 2: T A C G C A A A G A T C G A T C G A A C TmRNA Sequence:Amino Acid Sequence:Will there likely be any effects from the mutation? yes or no. Explanation: _______________________________________________________________________________________________________________________________What type of mutation is it? _______________________________________________________________________The following segment of DNA is part of the RNA-coding sequence of a transcription unit. If the bottom strand is template, which of the following RNA sequences would be transcribed? DNA: 5-'ATAGGCGATGCCA-3' 3'-TATCCGCTACGGT-5' O 5'-UAUCCGCUACGGU-3' O 5'-ACCGUAGCGGAUA-3' O 5'-AUAGGCGAUGCCA-3' O 5'-UGGCAUCGCCUAU-3'
- What is the amino acid sequence of the peptide that would be synthesized after transcription and translation of the following piece of template strand DNA? 5' 3' codon translations _________________________ codon amino acid T C A T G C G C A A C A AGU Ser ACG Thr CGU Arg UGU Cys UGC Cys GCA Ala UGA stopShown below is an E. coli's DNA sequence coding for XXR protein. The nucleotides are numbered 1 to 330. Transcription starts at the Transcription Start Site (TSS) that is the base located at position 57. -55 5' AATAAСTTGAGATTTTGATTGACАТССТТСТСАCAGAGCCTATAATACCТАТТТС 3' 3'TТАТTGAACTСТААААСТААСТGTAGCAACAGTGTCТСGGATATTATGGATAAAG 5' 56- 5' ТACGTATAGAСАСТСAGAGGAAAGACAGAGAGAGAGTTAGCATTGTACTАТСТСТ 3' 3' АTGCATATСТсTGAGTCTCCTTтстстстстстсТСААТСGTAACATGATAGAGA 5' 65- -105 --110 -140- 5' СТTTTAGATATATCTCТАТСТСТСТСАСТССАТСТТТСТCGTGTTAACACAAСА 3' 3' GAAAATCTATАTAGAGATAGAGAGAAGTGAGGTAGAAAGAGCACAAТТСTСТTGT 5' 111- -120- -130- -150- -160----165 166- --175- --185- -195 -205- -215-----220 ------- 5' GTCACAGACTCACAGATCTTTGTCGGTGATCGGAGATGGAGTTCCGGGAGAAGCT 3' 3' CAGTGTCTGAGTGTCТAGAAACAGCCACTАGССТСТАССТСААGGCCCTСТТCGA 5' 221- -230- 240 -250 -260 -270-----275 5' TTATAAGTTCAAGTTGCAATAGGTGTTTGCCTTTGTTTTATCTCTCCTCACCGTA 3' 3'ААТАТТСААGTTCAACGTTATCCАCAAACGGAAACAAAАТAGAGAGGAGTGGCAT 5' 276- -285- -295- -305 -315…18S rRNA is transcribed by Question 29 options: RNA polymerase I RNA polymerase II RNA polymerase III All of the above