S/what is the difference between SPM and AFM² // what is polymerase chain reaction (PCR) ? Show properties?
Q: Can we survive without carbohydrates and lipids? Explain your answer.
A: You most certainly can. However, there are ramifications. A no-carb diet eliminates almost all…
Q: UDP-glucuronosyltransferase enzymes bind the organic compound UDP-glucuronic acid (UDP-GA) in order…
A: Introduction: The major site for drug metabolism is the liver. It can be metabolized by oxidation,…
Q: The concept of “induced fit” refers to the fact that: a. enzyme specificity is induced by…
A: The primary purpose of enzymes is catalysis. Enzymes are extremely effective catalysts. Enzymes are…
Q: . When digesting a complex carbohydrate, water is added and, a simple sugar is obtained through…
A: During digestion the large molecules are broken down into simple molecules like during protein…
Q: Cerebroside does not contain Fatty acid chain Sphingosine Polypeptide chain Sugar Next
A: Cerebrosides : Common name for the glycosphingolipids group known as monoglycosylceramides
Q: How would IgG enhance innate immune system
A: Introduction: Immune system is a defense mechanism of body which protects us from any foreign body…
Q: What defect in the cell causes the condition known as Zellweger's syndrome, ZS? Explain in detail…
A: Zellweger syndrome is the most severe form of the Zellweger spectrum of conditions. It is a rare…
Q: Dihydrofolate reductase (DHFR) is an enzyme that reduces 7,8-dihydrofolate (DHF) to 5,6,7,8-…
A: To solve this question, we need to plot the LB Plot. The LB Plot has 1[S0] as X-axis and 1V0 as…
Q: Could someone please explain which sequence illustrates the order of the steps from food to…
A: Following digestion, the simpler compound produced is glucose, which would be metabolised to…
Q: Double-stranded regions of RNA: a. are less stable than double-stranded regions of DNA. b. can be…
A: RNA (ribonucleic acid) is a type of nucleic acid that is composed of ribose sugars, nitrogenous…
Q: I. Identify the D,L convention of the following monosaccharides CHOV HOSIT H -OH H- -OH HOH -OH 196…
A: a: L-Altrose b: D-Allose c: D-Mannose For identifying the convention of D and L, the structure…
Q: Polymerase with H2N-...GMMTVPPKKKRVGMMTV...-COOH Provide the amino acid sequence of the signal…
A: The amino acid sequence of the signal peptide is-…
Q: Chemistry help with c, d, e, and i.
A: In the citric acid cycle, the acetyl group of acetyl CoA molecule is completely oxidized. The citric…
Q: Using the DNA sequence Genetically modified TAC CAG ATA CAC TCC organisms (GMOs)- CCT, create the…
A: A mutation is an alteration in the nucleic acid sequence of a gene encoding a protein. Mutations…
Q: How can American diet led to the increase of type 2 diabetes and obesity in our country
A: Diabetes mellitus is a condition in which there is excess of glucose molecules in the blood stream…
Q: Mach the terms left with as many terms GMP Nucleotide at right by entering @ Nucleoside 3 Z-DNA…
A: Thank you for your question, Here is the answers for the above match the following with…
Q: * Glycerol is used for cosmetic preparations and synthesis of suppositories True False
A: Glycerol - Polyol compound and is colorless, odorless; a viscous liquid
Q: Explain in detail the condensation reactions to form Maltose and Sucrose from their monosaccharides.
A: Sugars are simple carbohydrates which are classified based on the number of monomeric units present…
Q: When activated extracellularly, G protein-coupled receptors (GPCRs) initiate which of the following?…
A: Introduction: G-proteins referred to as guanine nucleotide-binding proteins, that are required for…
Q: Bilirubin is conjugated in the hepatocytes to * O Gluconic acid O Glucuronic acid O Glucaric acid O…
A: Bilirubin comes from two different sources. Approximately 80% of bilirubin is produced by the…
Q: A. Dr. Randy Schekman introduced you to a yeast model system for studying membrane fusion and…
A: "Since you have posted a question with multiple sub-parts, we will solve the first two subparts for…
Q: Which statement(s) regarding ions is true when a neuron is at rest? Positively charged cations are…
A: Neurons are also known by the name nerve cells. These cells are referred to as the fundamental units…
Q: The following has the lowest energy per gram when oxidized Carbohydrate protein O ethanol O Lipids O
A: Nutrients are the compounds that provide us energy when they are oxidised. These nutrients like…
Q: What is the relation between GMO crops and the four of the principles of bioethics?
A: The word GMO stands for Genetically Modified Organism. GM crops or Genetically Modified crops have…
Q: Which of the following secondary structures would you expect to find on the surface of a globular…
A: Proteins are composed of amino acids. They are linked together by peptide linkages. Proteins have…
Q: During translation elongation cycle, which of the following step(s) is/are repeated for each amino…
A: Translation is a process by which proteins are synthesized from mRNA template. It involves all the…
Q: All Enterobacteriaceae ferment glucose. Explain, then, how glucose fermentation can be used to…
A: Enterobacteriaceae is a large group of bacterias which are stained Gram negative after Zn Staining.…
Q: There are various types of DNA-targeting drug, including DNA alkylating agents, DNA intercalators…
A: Cancer cells are produced due to mutations in the cell's DNA, such as loss of function mutation of…
Q: Using the information provided, calculate the delta G knot prime and the Keq value at 298K for the…
A: Glutamate dehydrogenase is an enzyme that catalyzes the oxidative breakdown of glutamate to furnish…
Q: The following has the lowest energy per gram when oxidized Carbohydrate protein ethanol O Lipids O
A: Introduction: Biomolecules are the macromolecules produced by the tissues of the organisms. They are…
Q: What is the condition associated with a deficiency on enzyme phenylalanine hydroxylase? albinism…
A: Enzymes are the catalysts that carry out biochemical reactions. These are proteins in nature.…
Q: All the following amino acids are formed from 3-phosphoglycerate except Group of answer choices…
A: Amino acids are synthesized by a series of metabolic processes and uses varied substrate to…
Q: Why is the AT base pair less stable than the GC base pair
A: DNA is a genetic material present in most living organisms and it is composed of nucleotides.…
Q: True or False In the presence of enzymes, the value of free energy of activiation (delta G°‡) for…
A: Enzyme: It is a biocatalyst that increases the rate of chemical reaction by lowering the the…
Q: Serum concentrations of acetoacetate and ß-hydroxybutyrate increase dramatically after a 3-day fast…
A: Acetone, acetoacetate, and beta-hydroxybutyrate are called ketone bodies. Ketone bodies are…
Q: What is the actual meaning of Biocompatible and biodegrable for the scaffolds for biomedical…
A: Biocompatible The property of material compatible with living tissue is called biocompatibility.…
Q: Where in cells does the TCA cycle occur? a. Mitochondrion matrix b. Mitochondrion intermembrane…
A: Introduction: TCA (tricarboylic acid cycle) is a cycle which takes place in eukaryotes. In this…
Q: Lactate dehydrogenase (LDH) plays an essential role in an exercising muscle, especially when the…
A: During cellular respiration, respiratory substrates like glucose may undergo complete or…
Q: What do you mean by food additives? What are the categories of food additives based on their…
A: Food is an essential part of our diets. There are many types of food such as freshly prepared in the…
Q: Inhibitory postsynaptic potentials cause what type of change at the post-synaptic membrane?…
A: Introduction: Post-synaptic potentials are neurotransmitter receptors that mediate changes in…
Q: "Chargaff's rules" about the composition of bases in DNA dictates that A. the sum of purine…
A: Chargaff's rules explain the structure and composition of DNA. Chargaff's rules include the…
Q: CHO CH₂OH CHO НО -H но- -H H-OH -OH H-OH НО -H H- HO-H H-OH CH.OH CH₂OH CH2OH PAS PES 16. an epimer…
A: The name for the following compounds are : PAS - D-arabinose PES - L-xylulose PIS - D-xylose POS -…
Q: What is the correct designation of this alkene? cis o trans
A: Cis alkene: The isomer in which the two groups attached to the carbons of the double bond (i.e.,…
Q: could you make powerpoint presentation subtopics for Fluorescent Protein-Based Biosensors and Their…
A: In live-cell mechanotransduction imaging and mechanopharmacological drug screening, biosensors based…
Q: Paul and his friends ate at a fast-food restaurant. Paul, who has a mass of 70 kg, had a…
A: MET or Metabolic Equivalent of Task is defined at the ration of the rate at which an individual…
Q: 1.Hexokinase binds D-glucose but not L-glucose. This is an example of? Chirality sustrate…
A: The active site of an enzyme is unique to itself and enzymes are in the form of L- amino acids fold…
Q: II. ILLUSTRATIONS. For each of the given proteins: . Draw the final location of the following…
A:
Q: The third step of the pathway glycolysis is made up of the two following reactions. i.…
A: Catabolism means the breakdown of large molecules into smaller ones. Catabolic pathways include such…
Q: How is Candida albicans diagnosed in person with Candidiasis? Mention specific tests and how it is…
A: Introduction: Candida albicans is an opportunistic fungal pathogen that is responsible for causing…
Q: 1. Draw the structure of the following fatty acids: (a) Stearic acid (b) Arachidonic acid 2. Draw…
A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…
Step by step
Solved in 2 steps
- What are the essential requirements for the polymerase chain reactionBONUS: Why do RNA viruses such as the COVID coronavirus, influenza virus and HIV have much higher mutation rates than DNA viruses such as Herpes viruses? O DNA polymerases which copy viral RNA have much higher mutation rates than RNA polymerases which copy viral DNA O RNA polymerases which copy viral RNA have much higher mutation rates than DNA polymerases which copy viral DNA RNA viral 60S ribosomes make many ore mutations than DNA viral 40S ribosomes O RNA viral gyrases make more mistakes than DNA viral helicaseswhich step of the polymerase chain reaction takes place at 98 degrees?
- Provide a brief description behind your choice? Virus-mediated transfer of cellular genetic material from one bacterial cell to another by means of virus particles is called: (A) transduction (B) transposition (C) transformation (D) transfection One strand of double-stranded DNA is mutated, changing all cytosines to uracils. After one round of replication of the mutated DNA strand, the melting temperature of the resulting DNA will: (A) be higher (B) be lower (C) remain the same (D) be double The Southern blotting technique is used for: (A) the detection of RNA fragments onmembranes by specific radioactiveantibodies (B) the detection of DNA fragments onmembranes by a radioactive DNAprobe (C) the detection of proteins on membranesusing a radioactive DNA probe (D) the detection of DNA fragments onmembranes by specific radioactiveantibodies Superoxide dismutase is an important enzyme for maintenance of red blood cells and is defective insome neurodegenerative diseases. What…Illustrate Polymerase Chain Reaction concepts using Ishikawa Diagram.What is the purpose and benefit of the polymerase chain reaction?
- 2. pBR3322, an artificially made plasmid, is shown below. ECORI Hindill BamHI Pstl Amp ORI ↓↓ Tetr pBR322 (4.36 kb) ↑ Pvull Xmalll Describe 3 features that this plasmid has and indicate each one on the diagram. i) ii) 111]Sensors detect the flash of light. DNA polymerase Unused deoxyribonucleotides are cleaved by apyrase. ATP is consumed by luciferase and light is emitted. AMP and PP, are converted into ATP by sulfurylase. Template strand Growing strand 3' TAGGCCTACACTTACGCGAATGT 5' 5' ATCCGGAT 3' dGTP dNTPs dNDPs dNMPs + P₁ PP₁ ATP [1]Compare and contrast the properties of DNA polymerase and RNA polymerase. Drag the appropriate items to their respective bins. can proofread using a 3'-to-5' exonuclease activity polymerize in a 5'-to-3' direction Only RNA can initiate strand synthesis catalyze phosphodiester bond formation to polymerize nucleotides into nucleic acids Only DNA use deoxyribonucleotide triphosphates as substrates can only extend an existing strand Both Reset Help dependent on a DNA sequence template use ribonucleotide triphosphates as substrates