.. Draw a DNA helix opened up to copy a single gene (CAREFUL this is NOT a eplication bubble). You can make lines straight and parallel if you would like 2. On the bottom strand starting in middle and pointing to the left, draw a 90 degree arrow to show the start of transcription. 3. Add 10 DNA bases of your choice (A,T, C or G) along the bottom line to left of the 90 degree arrow. 4. Add the complementary DNA bases along the top line. 5. Beginning at the 90 degree arrow, transcribe the DNA into RNA. Write the appropriate letters. Label this as mRNA 6. Label 5' and 3' ends of all nucleic acids. 7. Label the template strand and the coding strands of DNA. 8. Label the promoter. Upload steps 1-8 but on your own please practice all 4 possible flips of this. Arrow on bottom facing left or right. Arrow on top facing left or right.)

3. Shown below is a double-stranded bacterial (E. coli) DNA sequence coding for a hypothetical protein. Both strands are shown; the top strand reads 5' to 3' left to right, while the bottom strand reads 5' to 3' right to left. The nucleotides are numbered 1 to 100. NOTE: For this problem, transcription begins with and includes the red and underlined C/G (top strand/bottom strand) base pair and RNA polymerase proceeds from left to right along the DNA. 1 20 40 5'-GTGTCCGTСТААТАТТGTGAGATGTТАТАТСССGCСGTCAАСАССАТСАА-3' +------- +------- ---------+ 3'-САСAGGCAGATTATAACAСТСТАСААТАTAGGGCGGCAGTTCTGGTAGTТ-5' 60 80 100 5'-ACAGGATAATCGCCTGCTGGGGCAAAGGCGGTGAAGGTAAAGGTGTTGCC-3' ------+ 3'-TGTCCTATTAGCGGACGACCCCGTTTCCGCCACTTCCATTTCCACAACGG-5' a) Which strand is used as a template for transcription, the top or the bottom? b) Where would the promoter be relative to the start of transcription? c) What are the first 15 nucleotides of the resulting mRNA? Indicate the 5' and 3' ends of the mRNA. d) What…

1. What is the nucleotide sequence of the complementary strand of the DNA molecule: 5’-AATGCGATCTTCAT-3’?2. What is the nucleotide sequence of the mRNA transcribed from the template DNA strand: 3’-GCTACAAAAAGTCCATAATCGC-5’? Indicate the 5’ and 3’ ends.3. If the mRNA sequence you obtained in question 2 were to be translated, what would be the sequence of amino acids? Indicate the N-terminal and C-terminal amino acids.

2. Dr. Kim at Ewha Research Center performed shotgun Sanger sequencing on an unknown DNA sample, and obtained the following reads (12 reads). Since the length of each read is quite short, Dr. Kim ran the original sample in a gel electrophoresis, and realized that the original DNA is just 50 base pairs long. (Please note that the resolution of gel electrophoresis is not so good. Thus, we cannot figure out the exact length of DNA using gel electrophoresis in the real world.) 1) САСТС ССAGT GTACC T 3) GGAGT CAАТC GC 5) GGCTG TGCTT GG 7) GATGG CTGTG 9) CAGTG TAССT GCA 11) TGCAA GCCGA G 2) AGCCG AGATG GCTG 4) CTGCA AGCCG A 6) CTTGG AGTCA ATCGC 8) САСТС ССAG 10) GCTGT GСТTG G 12) TGCTT GGAGT (a) Find the sequence of the original DNA (reconstruction), and align each read with the reconstructed DNA sequence. (hint: put all reads on a ppt slide, and move them around to find overlaps.) (b) Calculate coverage at each nucleotide position of the reconstructed DNA, i.e., how many reads cover that…

6. Similar to the class notes (Intro to Genetics), a segment of DNA (shown below) contains a promoter segment (the first 9 base pairs), a ribosome binding segment (the next 6 base pairs), and a segment that codes for protein synthesis which is started by the rest of the base pairs. ACTCCATTGAACCATTTCTATGATCCGCTAACG-... TGAGGTAACTTGGTAAAGATACTAGGCGATTGC-... A. When the DNA is induced to be copied to mRNA, the top strand is coding, meaning that the mRNA makes an identical copy of the lower strand (replacing T with U) The mRNA copy starts with the ribosome binding sequence. What is the sequence of the mRNA that will go to the ribosomes? B. What are the first 6 amino acids of the protein that are coded for by the mRNA? C. What would the amino acid sequence be if... i. a transition mutation occurred on the final G in the mRNA? ii. all of the G & C bases in the protein synthesis portion had transition mutations? iii. a point deletion mutation occurred in the ATA sequence (in the lower strand…

1st choices: promoter, 3’ UTR, exon 1, 5’UTR 2nd: Met, Lys, Arg, Leu, lle 3rd: GCC, AUC, UGA, GAA

9. Identify the TRUE statement about the process of transcription: * ORNA polymerase requires an RNA primer molecule before it can begin transcript ODNA is not needed for the process of transcription. RNA polymerase binds to a promoter region in the DNA to initiate transcription. O During the elongation phase, RNA transcripts are built from 3' to 5'. 10. Which is correct? * Translation occurs in the nucleus; transcription occurs in the cytoplasm O Transcription occurs in the nucleus; translation occurs in the cytoplasm Both transcription and translation take place in the cytoplasm Both transcription and translation occur in the nucleus

2. Dr. Kim at Ewha Research Center performed shotgun Sanger sequencing on an unknown DNA sample, and obtained the following reads (12 reads). Since the length of each read is quite short, Dr. Kim ran the original sample in a gel electrophoresis, and realized that the original DNA is just 50 base pairs long. (Please note that the resolution of gel electrophoresis is not so good. Thus, we cannot figure out the exact length of DNA using gel electrophoresis in the real world.) 1) САСТС ССAGT GTACC T 3) GGAGT CAАТC GC 5) GGCTG TGCTT GG 7) GATGG CTGTG 9) CAGTG TACCT GCA 11) TGCAA GCGA G 2) AGCCG AGATG GCTG 4) CTGCA AGCCG A 6) CTTGG AGTCA ATCGC 8) САСТС ССAG 10) GCTGT GCTTG G 12) TGCTT GGAGT (a} Find the sequence of the original DNA (reconstruction), and align each read with the reconstructed DNA sequence. (hint: put all reads on a ppt slide, and move them around to find overlaps.) (b) Calculate coverage at each nucleotide position of the reconstructed DNA, i.e., how many reads cover that…

3. DNA polymerase made a mistake and added a C on the DNA template strand. In the space on the mRNA sequence below, write the added base. (Remember that the DNA template and mRNA are complementary. Mark the codons again and write the amino acid sequence beneath them. What do you observe? (5') CGUUACAAUGUAU CGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA 3' On this mRNA codon table, the first nucleotide in codon is to the left, the second is above, and third is to the right. 4. A mutation in the gene encoding the aminoacyl tRNA synthetase for valine (VAL) causes the tRNA binding site to have the wrong shape. In its new (mutant) shape, the enzyme can bind tRNAs for VAL and leucine (LEU). (not at the same time but enzymes work fast and there are lots of them) a. In cells with this mutant tRNA synthetase, will the protein product of translation match the original one you deduced in question 2? circle one: (YES / NO. ) b. If not, how does it differ? c. How many different version of the short…

3. In future lectures we will describe a technique known as Northern blotting that can be used to detect RNA transcribed from a particular gene. Briefly, in this method a specific RNA is detected using a short segment of cloned DNA as a probe. The DNA probe, which is radioactive, is complementary to the RNA that the researcher wishes to detect. After the radioactive probe DNA basepairs to the RNA, the RNA is visualized as a dark (radioactive) band on an X-ray film. As shown here, the method of Northern blotting can be used to determine the amount of a particular RNA transcribed in a given cell type. If one type of cell produces twice as much of a particular mRNA as occurs in another cell, the band will appear twice as intense. Also, the method can distinguish if alternative RNA splicing has occurred to produce an RNA that has a different molecular mass. 875 nucleotides 675 nucleotides 1 Northern blot 2 - 3 Lane 1 is a sample of RNA isolated from nerve cells. Lane 2 is a sample of RNA…