**Question 3**Which of the following is true for methyl-directed repair?- A. Methyl-directed repair cannot distinguish the template strand from the newly replicated strand.- B. Methyl-directed repair changes both the template strand and the newly replicated strand.- C. Methyl-directed repair corrects the DNA strand that is methylated.- D. Methyl-directed repair corrects the mismatch by changing the newly replicated strand.- E. Methyl-directed repair corrects the mismatch by changing the template strand.

DNA replication is a long process that is done at considerable speed and hence, in spite of being a…

which of the following is true for methyl directed repair O A. methyl directed repair cannot distinguish the template strand from the newly replicated strand. O B. methyl directed repair changes both the template strand and the newly replicated strand. O C. methyl directed repair corrects the DNA strand that is methylated. O D. methyl directed repair corrects the mismatch by changing the newly replicated strand. O E. methyl directed repair corrects the mismatch by changing the template strand.

which of the following is true for methyl directed repair O A. methyl directed repair cannot distinguish the template strand from the newly replicated strand. O B. methyl directed repair changes both the template strand and the newly replicated strand. O C. methyl directed repair corrects the DNA strand that is methylated. O D. methyl directed repair corrects the mismatch by changing the newly replicated strand. O E. methyl directed repair corrects the mismatch by changing the template strand.

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

The diagram below is of a short stretch of prokaryotic chromosomal DNA in the process of replication.Please supply the specific pieces of information requested by the boxes below.
DNA repair enzymes preferentially repair mis- matched bases on the newly synthesized DNA strand, using the old DNA strand as a template. If mismatches were instead repaired without regard for which strand served as template, would mismatch repair reduce repli- cation errors? Would such a mismatch repair system result in fewer mutations, more mutations, or the same number of mutations as there would have been without any repair at all? Explain your answers.
What is/are the attributes that make nucleotide excision repair (NER) and base excision repair (BER) similar and/or different from each other? Select the correct response: The NER pathway is the only one that can remove DNA lesions in the strand regardless of their size which is followed by attaching the correct strand, then sealed by a DNA ligase. They both use the enzyme DNA glycosylases that recognizes the damaged DNA segments and proceed with repairing the faulty base in the strand. They differ NER only repairs purine bases while BER repairs pyrimidine bases. They both remove the damaged parts of the DNA where the BER pathway corrects only the identified damaged bases which are usually non-bulky lesions. The NER pathway, on the other hand, repairs the damage by removal of bulky DNA adducts which is a short-single stranded DNA segment. They both utilize the enzyme photolyase to reverse the damages created by the faulty section of the DNA. They both remove the damaged parts of the…
Which of the followings statements are true about DNA polymerase? 1.) It can only go in one direction, meaning the lagging strand can't be synthesized continuously. 2.) It cannot start a DNA strand from scratch, so another enzyme is needed to create "primers" as a starting point. 3.) It cannot copy epigenetic marks (such as methyl groups) on its own; these must be "copied" onto the daughter DNA strand by other enzymes after DNA replication. 4.) All of the above
Which of the following is/are true regarding the enzyme primase? a: primase functions during cellular DNA replication. b: without primase activity, DNA polymerase in our cell can NOT begin synthesizing new nucleotide chains. c: primase uses dNTP building blocks d: primase is a polymerase enzyme e: primase functions AFTER DNA helicase activity. Ps: This has multiple answers. thank you.
Based on what you have learned with respect to various DNA repair pathways, decide the most appropriate pathway that would be used to repair the following types of DNA damage. Explain your reasoning. A change in the DNA sequence caused by a mistake made by DNA polymerase during replication In a fungal species, pyrimidine dimers induced as a result of UV exposure A double-stranded break that occurs during G1 and prevents completion of DNA replication
Take each of the DNA sequences and complete ALL of the following steps: i. Find the DNA Replication Complement of each strand ii. Transcribe the complement strand of DNA into an mRNA strand Translate the mRNA strand into an Amino Acid strand iii. a. ATGGACGTATAGATGACAGGTAGATGTTTCAGGGGGATTTATCGATAG b. ATGGCCATTGAGTGTCAAAAGTCTCAATGA First base U UUU UUC UUA UUG CUU CUC C CUA CUG G U -phenylalanine (Phe) -leucine (Leu) GUU GUC GUA GUG leucine (Leu) AUU AUC isoleucine (lle) Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Second base ACU ACC AUA ACA AUG methionine (Met) (start) ACG -valine (Val) UCU UCC UCA UCG CCU CCC CCA CCG GCU GCC GCA GCG C -serine (Ser) -proline (Pro) -threonine (Thr) -alanine (Ala) UAU UAC UAA stop UAG stop CAU CAC CAA CAG AAU AAC AAA AAG A -tyrosine (Tyr) GAU GAC GAA GAG - histidine (His) -glutamine (Gln) - asparagine (Asn) -lysine (Lys) -aspartic acid (Asp) -glutamic acid (Glu) CGU CGC CGA CGG AGU AGC AGA AGG G -cysteine…
In the scenario where a single strand break occurs in the DNA replication fork: a) What would happen if RecC failed to bind to the chi site? Explain briefly and draw out the step at which recombinational DNA repair would stall. b) What would happen if RecA failed to bind DNA? Explain briefly and draw out the step at which recombinational DNA repair would stall. c) Draw the resolved product of this Holliday junction if it's cleaved in the direction of the white triangles. Is the result a heteroplex or recombinant? A Strand Invasion Ⓒ Holliday Junction A Resolve
Identify the various types of DNA repair mechanisms known to counteract the effects of UV radiation. Drag the terms on the left to the appropriate blanks on the right to complete the sentences. Reset Help SoS repair is dependent on a photon-activated enzyme that cleaves thymine dimers. excision repair is the process by which an endonuclease clips out UV-induced dimers, DNA photoreactivation repair polymerase III fills in the gap, and DNA ligase rejoins the phosphodiester backbone. recombinational repair uses the corresponding region on the umdamaged parental strand of the same polarity. is a process in E. coli that induces error-prone DNA replication in an effort to fill gaps by inserting random nucleotides.
What is an advantage and a disadvantage of this repair system?
Indicate whether each of the following statements is true or false. If a statement is false, explain why it is false. A. The repair polymerase is the enzyme that proofreads the newly synthesized strands to ensure the accuracy of DNA replication. B. There is a single enzyme that degrades the RNA primers and lays down the corresponding DNA sequence behind it. C. DNA ligase is required to seal the sugar-phosphate backbone between all the DNA fragments on the lagging strand. D. The repair polymerase does not require the aid of the sliding clamp, because it is only synthesizing DNA over very short stretches. Answer the following questions about DNA replication. On a DNA strand that is being synthesized, which end is growing the 3' end, the 5' end, or both ends? Explain your answer. А. B. On a DNA strand that is being used as a template, where is the copying occurring relative to the replication origin-3' of the origin, 5', or both?
Please explain one type of “DNA repair” mechanism (what is it, when is it used, how does it work).