#2 EcoRI --- 5’ G ↓AATTC 3’   5’ ACG ACGTATTAGAATTCTTA TCCGCCGCCGGAATTCT CATCA 3’  3’ TGC TGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5’ Restriction enzyme:     Recognition sequence:     Number of pieces of DNA:    Type of cut:

Q: What is the role of the plasmid ? Explain the experimental details of the transformation. How can…

A: Recombinant DNA technology is also known as genetic engineering. It involves the manipulation/…

Q: Strand 1: C-G-T-A-T-C-T-C-A-T-A-G-C-TStrand 2 : A-A-A-G-A-T-A-T-C-A-C-C-C-AStrand 3 :…

A: The central dogma of molecular biology is that the DNA first undergoes replication to make a copy of…

Q: The recognition sequence for the restriction enzyme TaqI is T↓CGA. Indicate the products of the…

A: Restriction enzyme is a protein that recognizes a specific, short nucleotide sequence and cuts the…

Q: The following DNAs were incubated with E. coli DNA Polymerase I and dNTPs. Write the products…

A: DNA replication is the process by which new DNA is synthesized from the old DNA by semiconservative…

Q: digest suspect B's DNA using restriction enzyme 1. Restriction enzyme 1 cleaves the recognition site…

A: The restriction enzymes are endonucleases that digest DNA (deoxyribonucleic acid) molecules by…

Q: What is the mRNA coded by this template DNA strand? DNA Template Strand: 3' ATGGTACGGTCG 5'…

A: A codon is known to code by three different types of bases in a particular mRNA. Hence, a codon is…

Q: Restriction digestion and Gel electrophoresis: A single strand of a double-stranded DNA sequence is…

A: Restriction digestion is a process in which DNA is cut into smaller pieces at specific sites with…

Q: WT E. coli B ↓ Lysate titer on B K pfu/ml 10⁹ 10⁹ rll#x E. coli B ↓ Lysate titer on B 10⁹ K 103…

A: In genetics, map units or genetic distance is a way to measure how far apart two genes or mutations…

Q: In the boxes below, complete the DNA Replication and Transcription.

A: DNA replication is the process in which one of the strands of DNA is used as a template and a new…

Q: What is the RNA transcript that would result from the double stranded DNA segment shown below?…

A: Gene expression is mostly dependent on the transcription process, which creates RNA from a DNA…

Q: 3. A plasmid was cleaved with several restriction enzymes, individually and in combinations. The…

A: Restriction mapping is a technique for mapping an unknown section of DNA by breaking it down into…

Q: For the chromatogram below, what is the sequence of the template DNA from base 115 to 125?…

A: According to the question, we have to answer the question that which is for the chromatograph below,…

Q: 5'AGGCTCCAGG 3' Which complementary RNA strand can be made from this sequence? Select one: O a. 5'…

A: formation of m RNA from DNA is called transcription. RNA polymerase synthesizes m RNA by adding…

Q: Nde I EcoR I Sal I Kpn I BamH I PUST MCS ori Xho 1- Ampe BamH I Kpn I EcoR I BamH I gene W Xhe

A: Introduction  A chemical reaction is a process in which the reactants are converted into a product…

Q: Match the following DNA template segment with its complementary segment 5' AGGTCCG 3' 3¹ TCCAGGC 5¹…

A: The given question asks to match a DNA template segment with its complementary segment. DNA is made…

Q: Eight mutant bacteriophage strains cannot lyse a certain type of bacteria that can be lysed by…

A: Complementation test is used to determine which genes help each other to get a wild type phenotype.

Q: 24

A: GWAS is genome wide association study. The GWAS studies helps to identify genes association with a…

Q: The restriction enzymes KpnI and Acc65I recognize and cleave the same 6 bp sequence. However, the…

A: Restriction enzymes are specific endonucleases that are responsible for cutting double stranded DNA…

Q: Restriction enzyme:   Recognition sequence:     Number of pieces of DNA:  Type of cut:

A: In the question a DNA sequence is given with its nucleotides.  Restriction enzyme is an enzyme that…

Q: Map of pUC18 is shown on the here. Describe how to select recombinant clones if a foreign DNA is…

A: pUC18 plasmid is a derivative of the pBR322 plasmid, but its size is smaller when compared to…

Q: A researcher wants to cut this piece of linear DNA. 5 AGCTAGTCCGGATCCGAGGGCCCTTCTCATGAGATCCGGATGACC…

A: The discovery of restriction enzymes in 1968 by Swiss scientist "Werner Arber" ushered in the era of…

Q: Which of the restriction enzymes listed in the table below produces blunt-end fragments? Enzyme…

A: The blunt end are produced by the restriction enzymes when the end of a DNA fragment  after breaking…

Q: Use the gel to answer the following questions. You will be constructing a map of the plasmid,…

A: Plasmids have been used in genetic engineering for cloning and expression. These carry the genes for…

Q: Table 2. DNA Sequence 2 from Lactose-Tolerant and -Intolerant Individual Individual Phenotype…

A: Introduction:- Chromosome usually represent the long chain DNA molecules that have the genetic…

Q: 3000 bp 2000 bp 1000 bp 800 bp 700 bp 500 bp L Uncut EcoRI 1 BamHI Ncol EcoR1/BamH1 BamHI/Nco1…

A: Use the gel to answer the following questions. You will be constructing a map of the plasmid,…

Q: C RNA 5' UGGU I III II ACCAT CAGTC A G II TEMPLATE DNA 5' RNA polymerase

A: Transcription: Formation of mRNA from DNA with the help of enzyme RNA polymerase.

Q: 5-ccuaaucg-34 3'-acctgcctataccggattagetetgatectaagcatgte-5" The diagram above shows an RNA primer…

A: Given -  RNA primer :   B   5'-ccuaaucg-3"    C   Template strand :    A…

Q: following question is related to Restriction Enzymes and RFLP. Using EcoRl, which DNA sequence held…

A: Restriction enzymes, also known as restriction endonucleases, are a key tool in molecular biology.…

Q: MUTATION: Fill in the correct nucleotide base pairing and amino acid sequence of the mutated DNA…

A: Answer) The correct sequence of base pairs in mRNA would be - 5' AGGCACCAAAUAUGU 3'…

Q: 48 Second letter If any single nucleotide is deleted from the DNA sequence shown below, what type of…

A: The antisense DNA sequence is - 5' GGACCCTAT 3' The single nucleotide deletion can occur at any…

Q: What restriction enzyme (or enzymes) would you use to cut the following...   (Gene of Interest is…

A: Forward Primer:5'-TCTAGAGTCAATGAAACAACA-3'Explanation:This sequence starts with the same…

Q: What is the DNA template of the following DNA coding:  ATGGCTAACCTTGTA

A: The DNA template strand is a complementary strand to the DNA coding (sense) strand. It serves as a…

Q: Coding With the given coding strand perform the following 1. supply the correct non- coding strand…

A: DNA is a double helical molecule.

Q: Find the complement DNA sequences to the following DNA sequences: Sequence # 1: GATATAGT Sequence #…

A: Complimentary strands have complimentary base pairs of DNA Adenine base pairs with thymine Cytosine…

Q: Based on the following wild type DNA sequence, indicate if each of the mutations should be…

A: A mutation is a change in a DNA sequence. Mutations can result from DNA copying mistakes made during…

Q: 3000 bp 2000 bp 1000 bp 800 bp 700 bp 500 bp L Uncut EcoRI BamHI Ncol EcoR1/BamH1 BamHI/Nco1…

A: Plasmids are double-stranded circular DNA molecules. Due to their small size and stability, these…

Q: Restriction sites are palindromic, which means that they read the same in the 5′ to 3' direction on…

A: A palindrome sequence refers to a specific pattern of nucleotides that reads the same forward and…

Q: Decide on two restriction sites that you can use to clone this into pL4440’s MCS. Identify their…

A: DNA cloning restriction sites are specific DNA sequences recognized and cleaved by restriction…

Q: You will be setting up your diagnostic digest on three plasmids, the ones you began with, PGFPUV and…

A: In this question, we have to complete the table for the reaction mixture of a PCR experiment.

Q: 2a. Assume that replication has been initiated at that ORI. Provide the sequence of the primer that…

A: AT GC base pairing: In double stranded DNA, the guanine (G) base on one strand can form three…

Q: If the cloning was successful and the plasmid contained the elements needed for blue-white…

A: The screening of transformants after the cloning is a critical step as it allows the identification…

Q: ENE 2: Nose Style DNA Template Strand ATG- GGG- CTT- CTC- TTT MRNA tRNA Amino Acids APPEARANCE

A: Above table is codon anti-codon table for translation of DNA code into protein sequence.

Q: ull rain LTE 11:53 © 1 0 A 10% Done #1 Mol Bio Restriction Analysi... Complete the following…

A: Introduction  A plasmid is a genetic structure in a cell that can replicate independently of its…

Q: Indicate where each of the following processes occurs (nucleus, cytoplasm or mitochondria).…

A: In humans, the genetic information present in the cell is in the form of the Deoxyribose Nucleic…

Q: (a) Complete the table, using a letter D, R or B, to show whether each statement applies to: DNA…

A: Genetic material is the hereditary substance in the cell. It carries all information specific to…

Q: ure 1 is a bacterial gene (1-180). The first base to be transcribed is the base located at sition…

A: Transcription is a process in which RNA is formed with the help of template strand of DNA. It…