
Human Anatomy & Physiology (11th Edition)
11th Edition
ISBN: 9780134580999
Author: Elaine N. Marieb, Katja N. Hoehn
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
thumb_up100%
What is the consensus sequence of these three DNA sequences?
5' - G G T G C A C - 3'
5' - A A T T C A C - 3'
5' - G G T T C T C - 3'
Expert Solution

This question has been solved!
Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.
This is a popular solution
Trending nowThis is a popular solution!
Step by stepSolved in 2 steps

Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Polyglycine, a simple polypeptide, can form a helix with φ = -80°, ψ = +150°. From the Ramachandran plot (as shown), describe this helix with respect to handedness.arrow_forwardWhich of the following pieces of DNA is going to be easier to separate into single stranded molecules using heat (ie, have a lower melting point), which breaks hydrogen bonds? Why? 1. 5’ ATTTTCCGTAAT 3’ 3’ TAAAAGGCATTA 5’ 2. 5’ ACGGTTTACCGG 3’ 3’ TGCCAAATGGCC 5’ A) 2; it has more C-G pairs which are connected by three hydrogen bonds instead of two, so they are easier to break. B) 1; it has more A-T pairs which are connected by one hydrogen bond instead of two, so they are easier to break. C) 2; it has more C-G pairs which are connected by two hydrogen bonds instead of three, so they are easier to break. D)1; it has more A-T pairs which are connected by two hydrogen bonds instead of three, so they are easier to break.arrow_forwardBelow are some nucleotide sequences located on a segment of one strand of DNA, from the 5'to the 3' Indicate the complementary sequence of nucleotides that would appear on the adjacent DNA strand from the 3' to the 5' end. 5' AGTCCG 3' 5' CCTTGA 3'arrow_forward
- Refer to the DNA template strand below. Which of the following corresponds to the protein coding sequence portion of the corresponding mRNA? 5' - CTGTATCCTAGCACCCAAATCGCATTAGGAC - 3' O 5'- ATG CGA TTT GGG TGC TAG - 3' O 5' - AUG CGA UUU GGG UGC - 3' O 3' - GAC AUA GGA UCG UGG GUU UAG - 5' O 5' - CTA GCA CCC AAA TCG CAT TAG - 3' O 3' - GGA CAU AGG UAC GUG GGU UUA GCG UAA UCC UG - 5'arrow_forwardThe following nucleotide sequence is found on the template strand of DNA. First, determine the amino acids of the protein encoded by this sequence by using the genetic code provided in Figure 15.10. Then give the altered amino acid sequence of the protein that will be found in the following mutations: Q.Mutant 4: A T S A transversion at nucleotide 15arrow_forwardThe complementary sequence for the strand given below is 5' AUU CCU CCC AAU AUG 3' O 5 CAUAUUGGGAGGAAU 3 O 5' UAAGGAGGGUUAUAC3' O 3' GUAUAACCCUCCUUA 5' O3' AUU CCU CCC AAU AUG 5'arrow_forward
arrow_back_ios
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education

Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax

Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,

Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company

Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.

Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education