What is the effect of the insertion of a nucleotide in the 4th codon of the DNA sequence below? (Hint: write out and translate the original mRNA underneath the template DNA. Then, insert a nucleotide into the 4th codon and retranslate the sequence.) Template: 3'-TAC AAA CTA GTG AAT AGA TTT CCA CGT ACT GGG-5"

Q: Derive the amino acid sequence that is coded for by the following mRNA sequence. 5' CAU AAA ACG GUG…

A: During the translation, the information present in the mRNA sequence results in the formation of…

Q: 3' AAAACTGTGCAT5'

A: In order to take the needed information from DNA, cells first makes a copy of the DNA nucleotide…

Q: When RNA polymerase transcribes DNA, only one of the two DNA strands is used as a template.…

A: Transcription is the process in which a DNA strand gets transcribes into RNA by the help of RNA…

Q: What is the nucleotide order in the complementary mRNA that can be transcribed from the given DNA…

A: Transcription Cellular process in which RNA is synthesized using DNA as a template known as…

Q: What are the particular changes in the gene and protein sequences shown on the screen? Name the…

A: Mutation is the sudden change of a gene or chromosome from one to another. position 3 wild type…

Q: Which process is illustrated in the diagram? Pre-mRNA Exon 1 Lariat Exon 1 BEIN Intron Step 1 Step 2…

A: mRNA splicing is a process by which a newly made precursor messenger (m) RNA transcript is…

Q: A segment of a protein-encoding gene sequence is given below. 5’-AAGTTTGGCACT-3’…

A: Transcription is the process by which the genetic information encoded in DNA is copied into a…

Q: What is the amino acid sequence of the peptide that would be synthesized after transcription and…

A: In this situation, we are entrusted with figuring out the amino acid sequence of the peptide…

Q: Examine the following sequence of DNA 3’-CTA – TAC – TTA – CGC – GTA – CAT – GCG – TGA – CCC - ACG –…

A: The central dogma is a metabolic process where the  DNA acts as genetic material and transcripted…

Q: Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU…

A: The process of producing protein by association of mRNA and ribosomes is called translation. The…

Q: 5’-TAATTCTATGATATTAATATC -3’     mRNA sequence:     protein sequence:

A: The process of transcription of DNA to RNA and the RNA to protien  is based on complimantry DNA…

Q: What would happen if any of the stages involved in the translation of DNA to protein were…

A: Translation is a process in which ribosomes synthesizes the proteins in Cytoplasm after the…

Q: A section of template DNA has the following sequence of nitrogenous bases: 5’-CGATTACTG-3’. Which of…

A: Template DNA sequence - 5’-CGATTACTG-3’ After transcription the sequence - GCUAAUGAC Explanation -…

Q: Given the DNA sequence TATAGCACTGAT, which of the following is the correct complementary mRNA…

A: In the process of protein synthesis, DNA is transcribed into mRNA. Complementary base pairing rules…

Q: Pick the most complete list of mRNA sequences that translate into Ser.   Question 3 options:…

A: According to the question, we have to find out the option which is the most complete list of mRNA…

Q: Using the table above and the mRNA transcript AUG-CUC-UAC-AAG-UAG, choose the false statement: XXX…

A: Nucleic acids are involved in various processes in the cell, their main role is the expression of…

Q: 3' A TAT --IIL 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 DNA C GU UGA UG G MRNA TRNA Amino…

A:

Q: A cell has a mutated mediator protein. a) How will this affect transcription of genes? (circle an…

A: Transcription factors and RNA polymerase II interact with mediator complexes. The key job of…

Q: None

A: The given DNA3' CACTACGGCGCTGCGTGACCGATCACAGTGCGT 5' 5' GTGATGCCGCGACGCACTGGCTAGTGTCACGCA 3'  In the…

Q: Below is a double stranded DNA that contains an ORF. Identify the ORF and in the spaces below, first…

A: DNA DNA is a genetic material from which amino acid sequence or polypeptide chain are made.

Q: Using the following coding DNA sequence:TAC GCA CCT TTA GAT CAT AAC TTT GGA ACT1. Write the…

A: Deoxyribose nucleic acid (DNA) is the genetic material composed of four nucleotide bases, namely…

Q: 2a. Assume that replication has been initiated at that ORI. Provide the sequence of the primer that…

A: AT GC base pairing: In double stranded DNA, the guanine (G) base on one strand can form three…

Q: Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom:…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy-ribose nucleic acid whereas…

Q: Below is a diagram of charged tRNAs in the active site of the ribosome during translation of the…

A: Translation is the process of synthesis of protein. It takes place in the cytoplasm.

Q: if the following DNA sequence were transcribed, which of the following describes the output of this…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: Which of the following represents the sequence of an RNA transcript for which the coding strand…

A: A DNA molecule is a double-helical structure.

Q: How does the nucleotide sequence of the (+) DNA strand differ from that of the RNA transcript?

A: DNA contains both coding and non-coding region where introns are non-coding regions and exons are…

Q: What is the base sequence of a mRNA strand that is complementary to the DNA sequence 5'-ATCGGATTC-3'…

A: Transcription is the process by which an RNA molecule is synthesized from a DNA template. It is a…

Q: The nontemplate strand of a gene reads 5' ATGCGCTAGCTG 3'. What is the sequence of the mRNA…

A: Template strand runs in the direction 3' 5' end and non template runs in the direction 5' 3'. mRNA…

Q: 3’-TCTTCGTGAGATGATATAAGAGTTATCCAGGTACCGGTAAACTGG-5’…

A: The process of copying the information in a strand of DNA to produce an mRNA is called…

Q: Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom:…

A: Deoxyribonucleic acid (DNA) is a double-stranded, a self-replicating material that is present in…

Q: A gene contains the sequence CGCATACGGTAC that results in the amino acid sequence arg-ile-arg- tyr.…

A: The translation is a process where a mature mRNA sequence is converted into respective amino acids…

Q: Identify the labeled factors in the figure below (A and B) and indicate the direction of…

A: Hi dear, here's your answer.can you please give me an upvote. TBP and TFIIB bind and form stable…

Q: a. What polypeptide is coded for by the mRNA sequence: 5'-GCU-GAA-GUC-GAG-GUG-UGG-3'? N-terminus -…

A: A sequence of three consecutive nucleotides in messenger RNA (mRNA) coding for amino acids is…

Q: The following sequence of DNA is part of the normal, wild-type gene.   5'TAC CGG GAC TTG AGC CGA…

A: A single nucleotide from the DNA is deleted in nucleotide deletion. Although the single nucleotide…

Q: Given the following coding strand of DNA: 3' – TACCGAGTACTGACT – 5', the mRNA that will transcribed…

A: The method of constructing an RNA copy of a genetic sequence is known as transcription. The copy,…

Q: Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom:…

A: DNA and RNA are are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.