The arrow in the diagram below indicates the direction of transcription. TTT AUGCCGCAAUC B TTT ATGCCGCA TACGG B G -- GTTCACG Q Search Which letter indicates the 5' end of the DNA template strand? CACTCATET LO Direction of synthesis UCACG TGC 99+ D 8368 E F 0

For the messenger RNA sequence below, find the beginning of the amino acid coding sequence and translate the sequence using the genetic code provided below. 5' - AAUUAUGGGCAAUAUGCCGGGCcGGUUAAGCG - 3' Second Letter A UGU cys u UGC Phe UCU UU U UUC UUA UAU Tyr Ser UAC UAA UAG Leu UCA Stop UGA Stop UUG UCG Stop UGG Trp CUU CU CAU His CGU c cuc Leu ccc ССА CCG Pro CÁC CAA CAG CGC CGA CGG Arg CUA CUG Gin 1st 3rd letter Ser u letter AUU ACU AAU AAC AAA AAG Asn A AUC AUA AUG lle ACC ACA AGU AGC AGA AGG Thr Lys Arg Met ACG GUU G GUC GUA GUG GCU GAU GAC GAA Asp GGU Val GCC Ala GGC Gly GCA GGA Glu GCG GAG GGG G

3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’   5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’   Make vertical lines between codons to make this assignment easier to do.  Which strand is the template strand?  The first strand is the template strand as it going 3-5   Copy the template strand in mRNA.  Label the 5’ and 3’ ends.  5' AUG UUA CCC GCU GCG CGA AGC AAA GUC UAA 3” Write out the amino acid (you can use the short form) that this protein would be made of (keep in mind proteins are usually a minimum of 50 proteins.  Met-Leu-Pro-Ala-Ala-Arg-Ser-Lys-Val What do you notice about the mRNA strand compared to the non template strand of DNA?    2. What amino acid does the second codon code for on the DNA template strand?  ______Assume the 6th amino acid in the strand is changed from a T to a C. What amino acid does it code for now?  _______ What type of mutation is this?      3. Assume the 6th amino acid is changed from T to G on the DNA template strand.  What type of mutation is this?  What effect would…

30)

Using the genetic code below, decipher the following mRNA sequence.  5'CCCGGGAUGCGGUGUUGGUUUUAACCCGGG3' (show all work)

of estion 9 t of uestion THCA ▶ Sou 100- HC This reaction is Entropy is THC San Leafly ATA RNA polymerase SSSSSSSSSS ATTOGOGACATAA ATGACGGATCAGCCOCAAG UACUOCCUAGUC RNA Transcript TACTOCCTAGTCGGCOTTCOOCTTAACCOCTOTATIT (In this picture, RNA is being made by complementary base pairing with DNA.) This reaction is → Entropy is ◆

RNA Write the mRNA and the polypeptide made from the RNA. Translation DNA Template strand Transcription TTT TT TACGGCGTTAGACAAGTGCGTGAGTACACA ATGCCGCAATCTGTTCACGCACTCATGTGT ▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬||

Transcribe the following strand in Mrna, then translate it into amino acids

The sequence below is a template strand sequence for a gene (a very short one!). Identify the start codon and the amino acid sequence of this gene. Write your answer in 3 letter amino acid code. Put a hyphen between each amino acid. You should also include a description of any working or steps you have taken to determine your answer. 5' AGTCAGCAAGAAGACATCAGTGTTCCCATCTGT 3' Paragraph V B I U A = 8⁰ + v 11.

Please answer the following question, thank you!