The arrow in the diagram below indicates the direction of transcription. TTT AUGCCGCAAUC B TTT ATGCCGCA TACGG B G -- GTTCACG Q Search Which letter indicates the 5' end of the DNA template strand? CACTCATET LO Direction of synthesis UCACG TGC 99+ D 8368 E F 0

Q: Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that…

A: Mutation is defined as the change in the nucleotide sequence of DNA.

Q: This is the non-template strand of a double stranded DNA. RNA is transcribed from using one of the…

A: DNA serves as the genetic material and carries genetic information from one generation to another.…

Q: 5'- ATG CTG TTT GTA CGG GÁC TAA-3' a) Write out the DNA template side for the DNA coding side above?…

A: Introduction The term template strand refers to the sequence of DNA that is copied during the…

Q: 48 Second letter If any single nucleotide is deleted from the DNA sequence shown below, what type of…

A: The antisense DNA sequence is - 5' GGACCCTAT 3' The single nucleotide deletion can occur at any…

Q: Which process is illustrated in the diagram? NAA 5' Replication Transcription RNA processing…

A: Deoxyribonucleic acid, or DNA, is the genetic material found in humans and the majority of other…

Q: Using the following coding DNA sequence:TAC GCA CCT TTA GAT CAT AAC TTT GGA ACT1. Write the…

A: Deoxyribose nucleic acid (DNA) is the genetic material composed of four nucleotide bases, namely…

Q: How will this mutation affect the golden retriever puppy?

A: Transcription is the process which makes mRNA from DNA in complementary manner. The A, U, G and C of…

Q: What enzyme incorporated the incorrect nucleotide?

A: Introduction  DNA replication is a very speedy process where around 400 nucleotides are added per…

Q: Name of the enzyme that adds RNA Nucleotides during Transcription? O Helicase O Primase ODNA…

A: Option 4 is the answer.RNA polymerase.

Q: 5’ GGACCTATCAAAATCCTTATGCGCTAGGATAGCTAACGCATCCAC3’ This is the template strand. The +1 transcription…

A: Introduction :  One of the earliest steps in gene expression is transcription. The transfer of…

Q: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences…

A: Given DNA strand:  5' - CCTATGCAGTGGCCATATTCCAAAGCATAGC - 3'

Q: Given the following template DNA strand, what is the correct complementary DNA sequence? 3' CGC AGT…

A: Nucleic acids are present inside the nucleus to store and pass genetic information and thus controls…

Q: A certain section of the coding (sense) strand of some DNA looks like this: 5- ATGGGCCACTCATCTTAG-3'…

A: Mutations are changes in the nucleotide sequence of DNA. The mutations can therefore affect the…

Q: The following is the base sequence on the coding strand of a DNA molecule.          AAT GCC AGT GGT…

A: The coding strand is the DNA strand that has the same sequence as the mRNA except that it has T…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.