Suppose the coding (sense) strand of some DNA has this base sequence: 5-GATGTATA-3' Write the base sequence of the mRNA that would result from transcription of this DNA.

Q: DNA MANNMANN B mRNA Transcription Transport to cytoplasm for protein synthesis (translation) Mature…

A: Introduction :- Protein synthesis is the process of creating proteins from amino acids inside live…

Q: Explain why the translation of a given mRNA can be inhibited by a segment of its complementary…

A: A mechanism of reading and decoding the nucleotide sequences of messenger ribonucleic acid (mRNA)…

Q: How many tRNA molecules can associate with a ribosome at any given time during translation

A: The translation is the process of the formation of polypeptide chains of amino acids that lead to…

Q: mRNA sequence of A gene Find 5’ UTR and 3’UTR of mRNA 5’…

A: According to the central dogma of molecular biology, the information stored in the DNA is first…

Q: Suppose the codon sequence GCCAUUCAAGCGGAU has a single base pair mutation to GCCAUUCAAACgGAU. If…

A: DNA replication being very complex process, there are chances of miss reading the DNA template and…

Q: CDNA contains introns O exons both introns and exons

A: cDNA or complementary DNA is the DNA strand that is synthesized from the spliced mRNA to contain…

Q: What are the functional consequences of this deletion for lilP mRNA transcription and translation?…

A: Introduction :- A deletion mutation is a type of genetic mutation that involves the loss of one or…

Q: Based on your know | (hir sequence.

A: In many eukaryotic (and other prokaryotic) genes, the original RNA extracted from a genetic DNA…

Q: Using the DNA template –TACTGGGTACAAGAACA- for transcription, what is the base sequence of the mRNA…

A: The genetic code is stored in the DNA, which is coded in the messenger RNAs (mRNAs) by a process…

Q: Consider a template strand of DNA with the following sequence: 3 '–CAA TGT ATT TTT GCT–5 '. (a) What…

A: Gene expression is the process by which the instructions in our DNA are converted into a functional…

Q: Also answer Location number where correspond the 3 end of mRNA from this gene ans where u would find…

A: Exons are nucleic acid coding sequences that can be found in mRNA. Non-coding segments in DNA are…

Q: Give the translation of the segment of a polypeptide chain below. Specify your template strand.…

A: Transcription is the process by which RNA polymerase read out DNA and make m-RNA then mRNA is…

Q: Given DNA strand: 5'  T G T T A G T C G A A T  3'   Write its complementary DNA and its mRNA.

A: The DNA or deoxyribonucleic acid is the double standard helical macromolecule. It is the genetic…

Q: None

A: a) The informational strand (also known as the coding strand) of DNA is complementary to the…

Q: An mRNA which has a structure of 5' GCGCGAUCUGCCGCUUCGCUACUA 3' Give the corresponding ntein seque…

A: A single-stranded RNA molecule usually gets to referred as the term messenger RNA (mRNA) is…

Q: A strand of DNA containing the repeating sequence TAC GCT TTT GCG ATAACT could code for which of the…

A: When DNA is converted into RNA then this is called transcription.  When mRNA encodes protein then…

Q: What's the tRNA strand for the following mRNA strand: AUGGCUAACCUUGUA

A: Gene expression is the procedure through which data from a gene is employed in the production of a…

Q: If the sequence of the coding strand in a transcription unit is written as follows: 5'-…

A: In that question we have to write down the sequence of mRNA.

Q: Considering each nucleotide sequence in an mRNA molecule: [1] write the sequence of the DNA template…

A: Gene expression is the process by which the instruction in the DNA is converted to products through…

Q: Given a sequence of a DNA coding strand:     5’-ATGATTATCCTATAG-3’ What is the sequence and…

A: The synthesis of m RNA from DNA is called transcription.

Q: Considering the given sequence of nucleotides in an mRNA molecule, (a) what is the sequence of the…

A: Gene expression is the process by which the instructions in the DNA are converted to functional…

Q: DNA: 5’-CTCTACTATAAACTCAATAGGTCC-3’ -Write the sequence of the RNA molecule that will be…

A: The transcription is the process in which the mRNA copied information from DNA for protein…

Q: A sequence of nucleotides in a DNA strand—5′-ttAACggCttttttC-3′— was used as a template to…

A: A template strand is the strand of the DNA that is also called a non-coding strand. By complementary…

Q: The following segment of DNA in a hypothetical model organism encodes a polypeptide containing SEVEN…

A: Francis Crick proposed central dogma. The RNA is formed from DNA with the help of enzyme RNA…

Q: GIVEN THE FOLLOWING DNA SEQUENCES (+) OF THE GENBANK: INDICATE WHICH IS THE TEMPLATE MOLECULE, WHICH…

A: The template strand extends from 3' to 5'. The coding strand, that extends from 5' to 3' in…

Q: The relationship between the nucleotide sequence of an mRNA and the DNA strand from which it is…

A: According to the central dogma of molecular biology, the information stored in DNA is first…

Q: 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Copy the template strand…

A: DNA sequence is given. Top strand acts as template for mRNA synthesis. Top strand sequence is 3’…

Q: Suppose the codon sequence AUGACCCGGCUACUG has a single base pair mutation to AUGACCCGGUUACUG.…

A: Given,Original Codon Sequence: AUGACCCGGCUACUGMutant Codon Sequence: AUGACCCGGUUACUGOriginal Protein…

Q: Part A Which of the following processes is represented in the figure below? 3' AAG UGA RF1 RF2 O…

A: Thank you for the question  Answer :- The given picture shows translation termination Explanation :-…

Q: Enter the corresponding section of mRNA produced from the following section of DNA template strand:…

A: DNA or Deoxyribonucleic acid is the genetic material for most higher organisms and some viruses. RNA…

Q: explain why a mutation in the dna nucleotide sequence that corresponds to the 3rd nitrogen base in…

A: A mutation is a change that occurs in our DNA sequence, either due to mistakes when the DNA is…

Q: Using the base pairing rules which three rna bases pair with the following dna codon TAC

A: The two nucleic acids, DNA and RNA, present in the cell are polymers made up of nucleotides. These…

Q: A particular triplet of bases in the template strand of DNA is 5' AGT 3: The corresponding codon for…

A: Transcription is a heterocatalytic action of DNA by means of which RNA is synthesized from specific…

Q: Transcript the template DNA (write in mRNA codons) *

A: The synthesis of messenger RNA with the help of DNA is called transcription. The main enzyme of…

Q: Given this DNA strand: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ Identify the following: mRNA:…

A: The process by which DNA is copied to RNA is called transcription, and that by which RNA is used to…

Q: The binding specificity of σ subunit of RNA polymerase is dependent on DNA sequence.

A: Introduction The RNAP σ(Sigma) Subunit Is Involved In All Steps Of Transcription Initiation, As Well…

Q: 3’-TCTTCGTGAGATGATATAAGAGTTATCCAGGTACCGGTAAACTGG-5’…

A: The process of copying the information in a strand of DNA to produce an mRNA is called…

Q: Determine each of the following items using the hnRNA nucleotide sequence (enter the answer using…

A: "Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: If the sequence of the coding strand in a transcription unit is writtenas follows:5'…

A: The central dogma of molecular biology explains the flow of genetic information through the…

Q: protein. How would the protein produced from sequence #1 differ from the protein produced from…

A: The sequences provided are of a non-coding strand or template strand. mRNA is transcribed…