What information can you NOT get from a CDNA library from mouse liver cells? identify ORFS that are intact and uninterrupted by introns potentially identify genes that undergo alternative splicing None of the options are correct (i.e., all can be information available from liver CDNA library) identify all of the genes in the mouse genome have in hand the 5' and 3'UTR sequences for genes expressed in the liver

What information can you NOT get from a CDNA library from mouse liver cells? identify ORFS that are intact and uninterrupted by introns potentially identify genes that undergo alternative splicing None of the options are correct (i.e., all can be information available from liver CDNA library) identify all of the genes in the mouse genome have in hand the 5' and 3'UTR sequences for genes expressed in the liver

Case Studies In Health Information Management

3rd Edition

ISBN:9781337676908

Author:SCHNERING

Publisher:SCHNERING

Chapter3: Informatics, Analytics, And Data use

Section: Chapter Questions

Problem 3.30.1C

See similar textbooks

Similar questions

A protein has the following amino acid sequence: Met-Tyr-Asn-Val-Arg-Val-Tyr-Lys-Ala-Lys-Trp-Leu-Ile-His-Thr-Pro You wish to make a set of probes to screen a cDNA library for the sequence that encodes this protein. Your probes should be at least 18 nucleotides in length. Q. Which amino acids in the protein should be used to construct the probes so that the least degeneracy results?
Prokaryotes and eukaryotes show significant differences in gene expression and genome structure Briefly describe the principle of the lac operon gene expression in E. coli Describe gene expression and mRNA processing in eukaryotes starting from supercoiled DNA and ending in amino acid sequences Briefly describe two primary differences between prokaryotic and eukaryotic genomes Alternative splicing is one of the processes that only occurs in eukaryotes Define alternative splicing Describe the primary consequence of alternative splicing for adaptation and evolution
A protein has the following amino acid sequence: Met-Tyr-Asn-Val-Arg-Val-Tyr-Lys-Ala-Lys-Trp-Leu-Ile-His-Thr-Pro You wish to make a set of probes to screen a cDNA library for the sequence that encodes this protein. Your probes should be at least 18 nucleotides in length. a. Which amino acids in the protein should be used to construct the probes so that the least degeneracy results? b. How many different probes must be synthesized to be certain that you will find the cDNA sequence that specifies the protein?
The U1 splice donor site is critical for positioning of the U1snRNP for appropriate splicing. What site/region(s) participates directly in the phosphoester bond exchange that forms the lariat leading to the correct excision of the intronic segment? Options: the branch point adenosine the poly A stretch within the intron (high conservation ~80%) U2AF binding site (GU) at the 3' intron/exon junction a and b only a, b and c
Briefly discuss (referring to the images provided) why mutant 2 fails to produce functional protein. Note that none of the mRNA transcribed from this gene is of the expected size; some of the mRNA molecules produced are 223 nucleotides shorter than expected, whilst others are 47 nucleotides longer than expected.
You have recently cloned multiple cDNAs for a gene you are studying. After sequencing ten of the cDNAs, you find that seven of the cDNAs would produce a protein of 531 amino acids, while the other three cDNAs would produce a protein missing 30 amino acids from the center of the protein. This finding is can be explained by: O nonsense suppression O alternative splicing O basepair wobble O variability in the length of the poly(A) tail
Cladosporin has been shown to have insecticidal activities. You are about to test the function of the lysyl-tRNA synthetase in insects. You have found a couple of candidates of lysyl-tRNA synthetase genes in insect genome database. Explain how RNAi can be used as a tool to investigate the function of your candidate genes, include the process or mechanisms of RNA interference
The entire genome of the yeast Saccharomyces cerevisiaehas been sequenced. This sequencing has led to the identification of all the open reading frames (ORFs, gene-sizesequences with appropriate translational initiation andtermination signals) in the genome. Some of these ORFsare previously known genes with established functions;however, the remainder are unassigned reading frames(URFs). To deduce the possible functions of the URFs,they are being systematically, one at a time, convertedinto null alleles by in vitro knockout techniques. The results are as follows:15 percent are lethal when knocked out.25 percent show some mutant phenotype (alteredmorphology, altered nutrition, and so forth).60 percent show no detectable mutant phenotype at alland resemble wild type.Explain the possible molecular-genetic basis of thesethree mutant categories, inventing examples wherepossible.
From the list given - choose all the regulatory sequences that you think would control the expression of this eukaryotic gene THERE are multiple answer for this that I can choose Group of answer choices A 3' UTR B PPE sequences C 5' UTR D introns E core promoter F coding sequence G DNA-bending protein H enhancer sequence I mediator protein
Below is the double stranded DNA sequence of part of a hypothetical yeast genome encoding a very small gene. Transcription starts at nucleotide immediately following the promoter. The termination sequence is TATCTC. How many amino acids will this protein have? 5' TCATGAGATA GCCATGCACTA AGGCATCTGA GTTTATATCT CA 3' 3' AGTACTCTAT CGGTACGTGAT TCCGTAGACT CAAATATAGA GT 5'
Design a crispr crRNA portion of the gRNA for targeting myostatin gene in mouse for tracerRNA which starts with GTTTA All of the mentioned choices CGCCTCCACTCCGGGAATTG GAGACAAAACACGAGGTACA AAAGACGGTACAAGGTATAC
Introns in protein-coding genes of some eukaryotes are rarely shorter than 65 nucleotides long. What might be a rationale for this limitation?