5. Compare and contrast transcription and translation. Transcription Translation What is the Start point? What is the Stop point? Indicate the type of polymer generated. What type of Bond is formed in polymer? What are the ends of the new polymer? (5',3', N, C, hydrophilic, hydrophobic, etc.)

5. Compare and contrast transcription and translation. Transcription Translation What is the Start point? What is the Stop point? Indicate the type of polymer generated. What type of Bond is formed in polymer? What are the ends of the new polymer? (5',3', N, C, hydrophilic, hydrophobic, etc.)

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter15: From Dna To Protein

Section: Chapter Questions

Problem 5TYK: Which of the following statements is false? a. GTP is an energy source during various stages of...

See similar textbooks

Related questions

Q: Translation is the flow of information from: a) DNAàDNA b) DNAà mRNA c) mRNAà polypeptide d)…

A: Introduction Genome consists of DNA/RNA which consists of nucleotides either deoxyribose…

Q: 4. You have the following DNA strand. Synthesize a protein from this strand. (Recall that a leader…

A: We all know that Central dogma of life is a unidirectional flow of information from master copy DNA…

Q: 2.5 Which of the following is true about translation? A) The anticodon in the transfer RNA is…

A: t- RNA is called transfer RNA which changes to amino acyl RNA with help of the aminoacyl t-RNA…

Q: 4. Compare the DNA sequences of individuals with Alzheimer's disease and their family members. Two…

A: The amyloid beta precursor protein (APP) is coded by the APP gene that is located on the chromosome…

Q: 1. What is the concept of universality of the genetic code? What are the exceptions to this…

A: Introduction The sequence of nucleotides on m-RNA that code for an amino acid is known as genetic…

Q: 3. The following segment of DNA is the template strand: 5'-.GACATGGAA.-3' a. What is the sequence of…

A: DNA and RNA are are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid…

Q: 4. Is there any situation in which DNA is made based on a RNA template? If there is, explain with an…

A: Note: We will answer the first question since the exact one was not specified. Please submit a new…

Q: 1. From standpoint of replication and transcription, explain how RNA polymerase is allowed to…

A: Replication is the process of formation of two identical DNA copies from one parent DNA.For this…

Q: 5. You're working in Marshall Nirenberg's lab, trying to decipher the genetic code. You use several…

A: Introduction Marshall Nirenberg discovered a way to determine the sequence of the letters in each…

Q: 7 Which of the following is the correct polypeptide chain for the mRNA strand shown below?…

A: A codon is a group of three nucleotides in an mRNA grouped to code for a particular amino acid. The…

Q: 8. Some antibiotics work by preventing protein synthesis in bacteria by binding to their ribosomes.…

A: Multiple choice answer is given below:

Q: 1. During RNA splicing, the of the precursor mRNA are being removed. Exons Introns Promoters…

A: RNA splicing is a process by which non coding sequences of RNA are removed. The coding sequences…

Q: 2: Translation Translation MRNA Codon Amino Acid GAA Glu ACG GAU UAC CAG CCC AUG GGC

A: Translation includes the decoding of the information in the mRNA (messenger RNA) into the functional…

Q: 8) Which of these describes the function of RNA polymerase? A. Amplifies the “message" by making…

A: Need to find which of the following is correct regarding RNA polymerase function.

Q: 7. Draw a tRNA that would recognize the codon 5' A U G 3'. What is the sequence of this tRNA's…

A: As per the guidelines we are supposed to answer only the first question in case of multiple question…

Q: 1) A segment of DNA has the following sequence of bases ...5'-ATGCAATGATATTGAAGCTTA -3'... a.) what…

A: Transcription is defined as the synthesis of mature mRNA from antisense DNA template. Translation…

Q: 6. When can a mutation on the DNA cause production of a longer translation product? Give a specific…

A: * Types of gene variations Missence Nonsense Frameshift mutation Insertions Deletions Inversions…

Q: 2. What do you predict would happen if you created-a RNA with an anticodon of 5'-CAA-3' that is…

A: The translation of the proteins takes place as the mRNA having the codons are fitting into the…

Q: 9. A gene being expressed has the following partial DNA sequence: TACCAACCTACA. What would be the…

A: Here I will provide you mRNA sequence as well as amino acids sequences of the given DNA sequences.

Q: 3. Label the illustration below using the following terms: DNA, MRNA, codon, transcrip translation,…

A: All the living organisms contain genetic material. The genetic material is responsible for passing…

Q: 5. There is more than one codon and tRNA for most amino acids. The L-shaped molecule binds a…

A: Charged tRNA match an mRNA codon with the amino acid it codes. tRNA brings amino acids to…

Q: Hello, my question is in the picture below. Thank you in advance!

A: Transcription is the process of converting DNA into m-RNA in the presence of enzyme RNA polymerase.…

Q: 6. Describe transcription, include the following terms: mRNA, RNA polymerase, promoter, template…

A: "Transcription" and "Translation" are two important processes that take place inside the cell for…

Q: 3)Which of the following are involved in translation? Choose all that apply ribosome tRNA amino…

A: Answer- Involved in translation are :- ribosome tRNA mRNA rRNA amino acids

Q: 1. In the DNA sequence, the bottom strand is a template strand. If the base pair G-C (in bold) is…

A: Transcription is a process which involves formation of RNA molecules from DNA. One of the DNA strand…

Q: 3. On the diagram below, draw how the mRNA is translated into a peptide beginning with the third…

A: This question we have to describe about process of translation.

Q: 8. Which RNA molecule is NOT involved in the processes of transcription and translation? A.…

A: RNA or Ribonucleic acid is a type of nucleic acid. Transcription is the process of synthesis of…

Q: Select ALL of the following that apply to translation. Select one or more: a. occurs in the nucleus…

A: The translation is a process that is part of the central dogma that follows the process of…

Q: A life-form from another universe is found to have nucleic acid which includes six different bases -…

A: Disclaimer: “Since you have asked multiple questions, we will solve the first question for you. If…

Q: 5. What mutation(s) would eliminate peptide translation? Nonsense mutation

A: In the given case, the sequence of DNA is given. The RNA contains uracil in place of thymine. Thus…

Q: Which of the following is a true statement concerning condons

A: Codons are nucleotide triplets that are read together in order to specify amino acids during…

Q: 1. Analyze the following amino acid sequence and write down a potential mRNA sequence from which…

A: DISCLAIMER: Since you have asked multiple questions, we have solved the first question for you. If…

Q: 12) Which of the following processes occurs during transcription? A) DNA is replicated B) RNA is…

A: The information for the production of functional proteins are stored in segments of DNA called…

Q: How many codons are there in the mRNA?

A: Here, the given original DNA sequence is: 5'ATGCCTGGACGCAATGCGAGCTGGCTTAACTCAGGGCGTTGA3' So,the mRNA…

Q: The codon AUG on the mRNA codes for which amino acid (give the 3-letter abbreviation)? _______…

A: The translation is the process by which protein or polypeptide chain is produced from mRNA. The mRNA…

Q: 10. A portion of an mRNA molecule has the sequence 5'-AUGCCACGAGUUGAC-3'. What amino acid sequence…

A: 1. The genetic code is the set of rules followed by cells to read and translate the genetic…

Q: 7. Complete the following diagram which describes a small eukaryotic open reading frame, by filling…

A: Genes are the fundamental unit of heredity. They store genetic information in the form of DNA, which…

Q: 4) RNAI is the name used to describe a system that cells use to shut down the translation of…

A: ANSWER;- RNAi is mainly of two types: small interfering RNA(siRNA)- which are made artificially or…

Q: 1.) Define transcription and translation. How does transcription and translation differ in…

A: The organisms are differentiated on the basis of the number of cells. Unicellular organisms are…

Q: (6C) The diagram below shows the process of translation. protein moleçule forming Bead and re-read…

A: which of the following describe the role of the ribosome :

Q: 4. What is the nitrogen base pair of Adenine in transcription? * Cytosine O Uracil O guanine thymine…

A: Nucleic acid is biological macromolecules that is exhibited inside the nucleus is the cell. It…

Q: Which of the following initially comes directly in contact with the mRNA during translation? a. 60s…

A: "Since you have asked multiple question, we will solve the first question for you. If you want any…

Q: 1. What happens during transcription? Possible sentence frame: Transcription is the process in which…

A: Need to fill the blanks related to transcription process.

Q: 1. Convert the sequence from DNA to Amino Acids. 3-TCACCACTCTGGTCTGGTCATATCTGCCTGATATGAGTACAT - 5'…

A: The translation is a process in which the synthesis of protein is done from the mRNA. The sequence…

Q: 1) Transcription and translation both involve an initiation, elongation, and termination phase.…

A: A gene is the essential physical and functional unit of heredity. Genes are comprised of DNA. A…

Q: 5. When can a mutation on the DNA cause shortening of the translation product? Give a specific…

A: Mutation is the phenomenon in which the DNA sequence is altered. This may occur spontaneously.…

Q: 5. Create the complimentary strand for the DNA strand below. Make sure to label the parts and…

A: The base pairing rule of DNA is purine always pairs up with pyrimidine. Adenine(A) and Guanine(G)…

Q: 7. Complete the following diagram which describes a small eukaryotic open reading frame, by filling…

A: DNA ( Deoxyribonucleic acid ) is two stranded structure which functions as genetic material in most…

Q: 8. Complete the following table. Remember to label the 3' and 5' ends of all polynucleotides. Assume…

Concept explainers

Spheres of physical activity

The spheres of physical activity experience include aspects of everyday life where physical activity is important. In general, the spheres recognize various purposes of physical activity in different contexts. The spheres of physical activity provide a broad basis for assessing the significance and prevalence of physical activity. There are seven spheres of physical activity experience.

Question

Do all

5. Compare and contrast transcription and translation.
Transcription
Translation
What is the Start point?
What is the Stop point?
Indicate the type of polymer
generated.
What type of Bond is formed in
polymer?
What are the ends of the new
polymer? (5',3', N, C,
hydrophilic, hydrophobic, etc.)

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3

VIEW

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Which subunit of the E. coli polymerase confers specificity to transcription? a. b. c. d.
3. You have assembled a very short contig below, but you don't know if this is the sense or antisense strand. Determine the mRNA sequence in either case, and then provide a 6 frame translation. 5' - ATACGGGCAATTACAGTCTAGA – 3' If this is the sense (+) strand, what is the corresponding mRNA sequence? If this is the antisense (-) strand, what is the corresponding mRNA sequence? For BOTH mRNA sequences you just determined, provide a 3 frame translation for each (i.e. a 6 frame translation, in total)
1. The nontemplate strand of a segment of double- helical DNA contains the sequence: (5')CGCTATAGCGTTTAG (3') (a) What is the MRNA base sequence that can be transcribed from this double helical DNA assuming you already have a ready RNA polymerase present and everything else needed for RNA transcription? Label the sequence ends and list what is required for RNA Pol to work. (b) What amino acid sequence could be coded by the MRNA in (a)'s answer assuming the AUG start codon is just upstream of the MRNA (not shown in the sequence provided)? Use table in Figure 27-7 of the Lehninger 7 th ed "Dictionary of amino acid code words in mRNAs" and write the peptide according to standard convention with abbreviations for the amino acids. (c) If the wrong strand was transcribed and then translated from the section of double stranded DNA shown above, what would the resulting amino acid sequence be? What would the mRNA sequence be? Explain your answer and label all strands. A. First letter of codon…
1. The nontemplate strand of a segment of double- helical DNA contains the sequence: (5')CGCTATAGCGTTTAG (3') (a) What is the MRNA base sequence that can be transcribed from this double helical DNA assuming you already have a ready RNA polymerase present and everything else needed for RNA transcription? Label the sequence ends and list what is required for RNA Pol to work. (b) What amino acid sequence could be coded by the mRNA in (a)'s answer assuming the AUG start codon is just upstream of the MRNA (not shown in the sequence provided)? Use table in Figure 27-7 of the Lehninger 7 th ed "Dictionary of amino acid code words in mRNAs" and write the peptide according to standard convention with abbreviations for the amino acids. (c) If the wrong strand was transcribed and then translated from the section of double stranded DNA shown above, what would the resulting amino acid sequence be? What would the MRNA sequence be? Explain your answer and label all strands. 歐歐队相阳阳一即即的 9 First letter…
1. What is the production of RNA called and what is the enzyme that catalyzes the process?2. What are the similarities and differences between the transcription process and the repli-cation processes?3. Concerning their biological function what is the difference between DNA and RNA?4. Is there any situation in which DNA is made based on a RNA template? If there is,explain with an example how it occurs and state the enzyme involved?5. What is the difference between plasma membrane and cell wall?
1. What is the production of RNA called and what is the enzyme that catalyzes the process? 2. What are the similarities and differences between the transcription process and the repli- cation processes? 3. Concerning their biological function what is the difference between DNA and RNA? 4. Is there any situation in which DNA is made based on a RNA template? If there is, explain with an example how it occurs and state the enzyme involved? 5. What is the difference between plasma membrane and cell wall? 6. What are the main respective constituents of cell walls in bacteria, protists, fungi and ts? 7. What are the main structures within the cell nucleus? 8. Describe the basic constituents of the cell membrane? 9. What is cellular regeneration? How is mitosis related to this process? 10. What are the respective functions of phospholipids, proteins and carbohydrates of the cell membrane?
(1) Give 3 differences between DNA and RNA (2) Give 2 similarities and 2 differences between transcription and replication (3) A DNA strand is 5' TAC ACG GTC TAA3' Write the RNA strand that could be made from the DNA strand. Indicate the 5' and 3' ends For each of the following, say whether they are DNA or protein Enhancer Transcription Factor Promoter RNA polymerase
3. Differentiate between factors and processes involved in transcription: Recognition of this DNA sequence is [Choose] required for transcription to initiate:. [ Choose ] PROMOTER Occurs when the ribosome reaches a RNA POLYMERASE stop codon on the MRNA TERMINATION INITIATION SITE ENHANCERS The main enzyme responsible for transcribing DNA into RNA is ELONGATION Will increase the efficiency of gene [Choose] expression, but are not essential for transcription. RNA polymerase "walks" along the template strand, adding a [Choose ] matching (complementary) RNA nucleotide to each existing ncleotide. The section of DNA from which the [Choose ) very first 5" RNA nucleotide is transcribed Question 4 1 pts hp 近

1. The diagram below depicts an active transcription bubble after a short period of RNA synthesis during the transcription process of a prokaryotic gene. Redraw the diagram and label parts (i) to (v) on the diagram. Motivate your answers. (i) the template and the non-template strands; (ii) the orientation (direction) of both DNA strands and that of the newly synthesised RNA strand; (ii) the location of a possible promotor sequence; (iv) the location of a possible Shine-Dalgarno sequence; (v) the specific area of activity of a RNA polymerase.
1.- Outline the general process of transcription (dna->rna) include a diagram a) include the basic enzymes involved and a description of their actions b) what is the product of transcription c)what will the cell do with the product d)where does the transcription take place in prokaryotic cell
2.- Draw a step by step diagram of the translation process then explain what is happening in each step a) include the role of the ribosome, tRNA, mRNA, b) where does translation begin on the transcript? c) what would be the amino acid sequence of the transcript that was created?
1.) Define transcription and translation. How does transcription and translation differ in prokaryotes vs. eukaryotes (i.e. What is present in one but not the other)? 2.) What it means when we say that genetic code is redundant? 3.) Describe the stages of transcription (in detail for each step) - what components are required? 4.) Describe the stages of translation in eukaryotes (initiation, elongation, termination)