Q: 4e. You also study the expression of 3 different mutants for this gene. For each mutant answer the…
A: Promoted is the sequence of nucleotides found in the DNA for binding of transcription factor during…
Q: What are the eight ways gene expression can be regulated? Please summarize each in one-two sentences
A: There must be some sort of regulation on how much mRNA is translated into proteins after the DNA is…
Q: Explain how changes in your epigenome can alter the DNA of your future children before they are even…
A: Epigenome refers to all of the modifications that regulate the activity of the genes within a…
Q: Which of the following statements about epigenetics is correct? 1. Twins have identical epigenetic…
A: Epigenetics is the study of heritable changes in gene expression that do not involve changes to the…
Q: Proteins that are always present in the cell are encoded in genes that are __________ expressed,…
A: In a cell, a gene is a segment of DNA that can has instructions to form a protein. Gene expression…
Q: What choice best descirbes how genes are used in different cell types in your body. An example of…
A: Gene- Gene term was introduced by Wilhelm Johannsen in 1909 and the definition has been refined many…
Q: The only thing that effects gene expression is if the gene is dominant Choose: A. Yes, all…
A: Gene expression is the process in which genetic information can be interpreted as phenotype. The…
Q: Tamoxifen needs an enzyme that is not found in the genes of Asians, but is used to prevent breast…
A: Tamoxifen-- Tamoxifen is a class of medication known as antiestrogen , which blocks the activity of…
Q: What are RIBOSWITCHES and how are they important in studying the regulation of Gene Expression
A: A riboswitch in an mRNA molecule can directly control its own expression.
Q: What is effect of turning on and off of genes? How do we measure gene expression? What is gene…
A: Answer1) The effect of turning a gene on and off is observed on its expression and ultimately on the…
Q: Which statement is correct? Cells in the muscles have different structure and function than skin…
A: Gene regulation is how a cell control which gene out of a particular genome has to be 'turned on' or…
Q: How machinery of gene regulation is controlled by cell signaling?
A: Cell signaling is a process, during which extracellular ligand molecules get binds to the receptor…
Q: Which of the following statements about epigenetics is correct? 1. Epigenetic drugs could be…
A: Genes are the energy currency of the organisms. These genes are present in the DNA of the cells.…
Q: Although each cell in your body contains the same set of genes, the genes that are “turned on”…
A: Genes are the sequence of nucleotide found on our DNA which is capable of undergoing transciption…
Q: How does finP inhibit TraJ from activating expression of the tra genes? O It basepairs with the traJ…
A: Here both FinO and FinP play important role TraJ, is controlled by the action of the antisense RNA,…
Q: How does the control of gene expression in prokaryotes differ from that of eukaryotes
A: The gene expression the process in which the genetic information present in the DNA (gene) is copied…
Q: Why does a muscle cell express a different set of genies compared to a white blood cell? Why do…
A: The muscle cells and the white blood cells comprise different sets of genies depending on different…
Q: 3. Figure on the right shows a DNA microarray assay of gene expression levels. In this microarray if…
A: Micro arrays are utilised for the determination of gene expression patterns in specific tissues or…
Q: How is RNA splicing related to our lives and why it is so important
A: RNA is the biomolecule that is synthesized by the transcription of the DNA of an organism. The mRNA…
Q: Regulation of gene expression is necessary because: A) all cells do not need to express all genes…
A: Gene expression is the process by which the instructions in our DNA are converted into a functional…
Q: once transcription is complete gene expression is controlled by..........?!
A: In eukaryotic cells, after the transcription, the RNA needs to be modified or Processed into a finer…
Q: e. You also study the expression of 2 different mutants for this gene. For each mutant answer the…
A: ORF stands for open reading frame. It is found between the start and stop codon.
Q: do neutral mutations affect gene expressi
A: Except for some viruses, most animals' genetic material is a double-stranded molecule called DNA. A…
Q: Write TRUE or FALSE. If false, write the word/s that make(s) the statement incorrect. 1.Metabolic…
A: Since you have asked multiple questions, we will slove the first question for you. If you want any…
Q: How gene expression is controlled? (min 500 words)
A: The genes are the components of the genome that direct specific functions in the cell. Their…
Q: Can the compound cause expression for each gene.
A: Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: What does "feed back" mean gene regulation in gene expression ?
A: A particular organism's genome has thousands of genes, however not all of these genes must be active…
Q: What areas of the brain do you think are affected when there is a decreased expression of ERα mRNA…
A: * The estradiol is the harmone which will do protection actions. *This will help effects the long…
Q: Based on my your observations, describe the role of the transcription factors and the regulatory…
A: Central dogma involves a method where RNA formed from DNA , and DNA shows heterocatalytic neture,…
Q: What does it mean to say that a gene is expressed? DNA contains the information needed to make a…
A: Numerous cells aggregate to make up the whole body. Cells are the building blocks of the body. Cells…
Q: Why is it important to regulate gene expression?
A: Gene can be defined as the segment of the DNA. It consists of the information of the individual's…
Q: Muscle cells are different from nerve cells because they: contain different genes express different…
A: Answer : Option "B" is correct Express Different genes
Q: In your own words, explain epigenetics. What is it? What are the main epigenetic marks? What do they…
A:
Q: Discuss what message does a gene provide? How is the language of the gene expressed?
A: The simplest physical and functional unit of heredity can be defined as a gene. DNA is what makes…
Q: How gene therapy or cell therapy can help cure diseases? What kinds of diseases do gene and cell…
A: Since you have posted a question with multiple sub-parts, we will solve the first three subparts for…
Q: DNA and RNA are information molecules with different roles in gene expression. List three…
A: DNA means deoxyribo nucleic acid.It is a molecule made up of two polynucleotide chains that are…
Q: 4e. You also study the expression of 3 different mutants for this gene. For each mutant answer the…
A: [Note: Although the question mentions 3 mutants, only two were given. So, we will answer for the two…
Q: Person A expresses a gene that can regulate the expression of multiple language genes. What could be…
A: Humans have unique natural ability to develop high complex linguistic systems. It is an ability that…
Q: What is Gene translocation? Would a mutation in one of your muscle cells affect your offspring? Why…
A: Mutations are changes in the sequence of nucleotide of DNA.
Q: How do cells control gene expression? How do cell "switch" genes on/off? Draw a flow chart to match?
A: The genes are regulated from time-to-time to make changes in the organisms. The way in which…
Q: What is a TATA box? Where is it located? What is a promoter? Where is it located in comparison with…
A: “Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: Epigenetics: are DNA mutations in response to the environment 2) injuries proteins 3) changes the…
A: Genetics is the branch of science which deals in genes and heredity. Study of genetics allow us to…
Q: Which mechanisms for regulating gene expression may be applied for the treatment of such diseases?…
A: Gene expression is the process by which information from a gene is used to make a protein. Gene…
Q: Are all of your genes expressed in every cell in your body? Explain your answer and include an…
A: Ans. We have trillions of cells in our bodies. A variety of different organelles, such as…
Q: In the gene in the fruit fly (Drosophila) called antennepedia. It controls the formation of which…
A: Mutations can be defined as the alteration in the sequence of the nucleotide of the genome.…
What 2 things are most responsible for controlling gene expression?
Step by step
Solved in 2 steps
- How does position effect influence gene expression? 1 | The movement of the genetic material on the chromosome by inversions or translocations may place a coding sequence near a new regulatory region, thus activating the expression of the gene. The movement of the gene may place it into a region that is highly condensed (heterochromatin). The movement of a gene may remove it from its normal promoter, thus silencing the gene. O All of the above answers are correctWhat is the process of gene expression? and what role does RNA play in gene expression?In your own words, explain epigenetics. What is it? What are the main epigenetic marks? What do they do in terms of gene transcription? What are the enzymes involved?
- When & how genetic expression occurs ?Gene expression is... O How genes are replicated into two new strands identical to each other O How genes are duplicated, forming a new gene O How genes are mutated, creating a new allele O How genes are transcribed and translated into proteinWhat is effect of turning on and off of genes? How do we measure gene expression? What is gene regulation, explain extensively?
- How 6mA controls gene expression ?Control of gene expression in eukaryotic cells occurs at which level(s)? only the transcriptional level epigenetic and transcriptional levels epigenetic, transcriptional, and translational levels epigenetic, transcriptional, post transcriptional, translational and post translational levels1. (a) RNA polymerase synthesis in a 5 -3 direction Gene is switched ON Gene is switched OFF Does NOT affect the gene expression (b) DNA synthesis in a 5 -3 direction Gene is switched ON Gene is switched OFF Does NOT affect the gene expression
- How do cells control gene expression? How do cell "switch" genes on/off? Draw a flow chart to match?4e. You also study the expression of 3 different mutants for this gene. For each mutant answer the following: Does this mutation change the sequence of the protein produced? Why or why not? If it does change the sequence of protein be sure to write out the new sequence. If it does not change the protein sequence, what effect (if any) would you expect it to have on expression of the gene? 1 20 ORI 40 60 5..ТТCGAGCTСТСGТCGTCGAGATACGCGATGATATTACTGGTААТАТGGGGATGCАСТАТС..3' 3'...AAGCTCGAGAGCAGCAGCTCTАTGCGСТАСТАТААТGACCATTATAССССТАСGTGATAG..5' * promoter i. Mutant A has a single base pair substitution with the T/A being replaced with C/G base pair at position 35 (position denoted by the * in the sequence above). ii. Mutant B has a 2 G/C pairs inserted between position 19 and 20 (position denoted by the ^ in the sequence above).4e. You also study the expression of 3 different mutants for this gene. For each mutant answer the following: Does this mutation change the sequence of the protein produced? Why or why not? If it does change the sequence of protein be sure to write out the new sequence. If it does not change the protein sequence, what effect (if any) would you expect it to have on expression of the gene? 1 20 ORI 40 60 5'...TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC...3' 3' ...AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCATTATACCCCTACGTGATAG...5' * promoter
