1. (a)  RNA polymerase synthesis in a 5 -3 direction     Gene is switched ON     Gene is switched OFF     Does NOT affect the gene expression (b)  DNA synthesis in a 5 -3 direction     Gene is switched ON     Gene is switched OFF     Does NOT affect the gene expression

Q: Which of the following features is common to both DNA replication and RNA transcription?     Both…

A: Nucleic acids, made up of nucleotide bases, as deoxyribonucleic acid (DNA) and ribonucleic acid…

Q: Section B: True / False (5 marks) 1. Primase has a DNA dependent RNA polymerase activity. 2.…

A: True or false statement Primase is a kind of RNA polymerase that is involved in the replication of…

Q: 5. Consider eukaryotic transcription: a) Draw a eukaryotic gene and label key sequences. (5 points)

A: A eukaryotic gene, consists of a set of sequences that appear in mature mRNA interrupted by introns.…

Q: 1. Differentiate the genotype and phenotype of a cell. 2. If deoxyribonucleotides that lack the…

A: In an organism the genetic matter is present inside the genes present in the chromosome of the…

Q: Given the amino acid chain below, get the (a) translation strand, (b) transcription strand strand,…

A: DNA is double stranded. There one strand is the template strand and the other is non-template. From…

Q: Describe the main steps in using the polymerase chain reaction to amplify a small amount of DNA.

A: Polymerase chain reaction or PCR is a technique which has been used widely to produce multiple…

Q: Please help Why did we use biodegradable nanoparticles? Please use The worksheet below and don’t…

A: Biodegradable Nanoparticles (BNPs) are basically particles with matter of interest (such as gene…

Q: Binding of transcription activator protein     Gene is switched ON     Gene is switched OFF…

A: Transcription is a process by which information of DNA segment is copied into the mRNA and it is…

Q: Using the DNA sequence above, write a new DNA sequence from 3’ to 5’ that incorporates a…

A: A missense mutation is a type of point mutation where a single nucleotide change in the DNA sequence…

Q: 1. Transcribe and translate the mutated DNA sequences, CIRCLE the mutation, and classify each type…

A: The change in the sequence of the genetic material of an organism that results in any heritable…

Q: occasionally, an effor occurs during DNA replication that changes the nucleotide sequence. Aven that…

A: The process by which DNA is copied to RNA is called transcription, and that by which RNA is used to…

Q: a. Indicate whether point C is a 5' end or a 3' end of a nucleic acid. b. Indicate which strand…

A: The ribonucleic acid was the primary genetic material. It acts as a genetic material furthermore as…

Q: 4. The template strand from the previous question is mutated to the DNA sequence shown below: 3' GTC…

A: transcription is the process by which messenger rna is made from dna .

Q: . Which of the following statements about the flow of genetic information is correct? A. Translation…

A: Genes are the basic hereditary molecules that carry hereditary information in them. They are present…

Q: For transcription to occur, the promotor region of DNA will a) Make a DNA copy of the DNA template…

A: RNA polymerase is the key central enzyme that regulates the transcription process. Prokaryotes need…

Q: REPLICATION TRANSCRIPTION TRANSLATION The specific location in the cell where the process happens…

A: The Central Dogma of life involves three steps: DNA ==> DNA ==> RNA ==> Proteins The…

Q: Each peak in a chromatogram corresponds to: A fluorescent ddNTP which has been released from the…

A: Ans-.  A fluorescent ddNTP which has been incorporated into the DNA fragment resulting in the…

Q: 1. The nontemplate strand of a segment of double- helical DNA contains the sequence:…

A: Since you have posted a question with multiple sub-parts, we will solve the first 2subparts for you.…

Q: Which of the following processes of genetic information flow can occur under lab conditions, but has…

A: The DNA (deoxyribonucleic acid) is the double-stranded molecule which is the genetic material in…

Q: (a.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGCAAATTCCTGCCAT…

A: Introduction :- Mutations are the hereditary changes that occurs in the Genetic material (DNA) of…

Q: 1) Describe the dna transcription-mRNA with all the step.

A: The discovery of DNA as genetic material is one of the most significant discoveries in molecular…

Q: 1.2 A colony of bacterial cells is exposed to UV-light. 1.2.1 What mutation will probably result…

A: MUTATION FROM UV LIGHT EXPOSURE Ultraviolet light induces specific mutations in the cellular and…

Q: A gene affecting the behavioral outlook of individuals was discovered in several humans who can…

A: Transcription is the process of the formation of RNA from DNA. Through transcription, the…

Q: TRUE OR FALSE: a) Okazaki fragments are short DNA pieces that explain how the DNA polymerase can…

A: DNA replication process is semi conservative. The semi conservative replication of DNA refers to the…

Q: A strand of DNA is composed of: A 30%, T 15%, G35%, and C 20%. What is the composition of the…

A: Answer:- (4) A 15% , U30%, G20%, AND C35%

Q: (A) Prokaryotic gene expression is a complex process that is controlled at many levels…

A: Since you have posted multiple questions, we will provide the solution only to the first question as…

Q: Compare and contrast Retroposon & Transposon. What makes them similar, what makes them different?

A: Jumping genes or mobile DNA elements are also referred to as short DNA sequences that are able to…

Q: Which one is not a part of the transcription unit? a) RNA primase b) Promoter c) RNA coding sequence…

A: Deoxyribonucleic acid (DNA) is a double stranded helical genetic material containing thousands of…

Q: Some antibiotic drugs fight infection by interfering with DNA replication, transcription, or…

A: The central dogma of molecular biology explains how the instructions within the DNA of an organism…

Q: DNA replication Transcription Polymerase moves along DNA template from 5' to 3' or 3' to 5? What is…

A: Central dogma, is  a process by which genetic information is being transferred from DNA to protein…

Q: How does the nucleotide sequence of the (+) DNA strand differ from that of the RNA transcript?

A: DNA contains both coding and non-coding region where introns are non-coding regions and exons are…

Q: Which of the following processes of genetic information flow can occur under laboratory conditions,…

A: The DNA (deoxyribonucleic acid) is the double-stranded molecule which is the genetic material in…

Q: (a) Which of the following statements is TRUE?     DNA polymerase moves in a 5 to 3 direction in…

A: The biological process by which the information encoded inside a DNA (deoxyribonucleic acid)…

Q: A set of nucleotides in an original DNA strand reads: TAC GCG AAT Transcribe this short DNA…

A: Gene is the sequence of nucleotides in a DNA. It encodes a protein.

Q: The arrow in the diagram below indicates the direction of transcription. A BTTT…

A: Q. Ans:- The given image shows the process of transcription. Transcription:- Transcription is a…

Q: 1. (a)  Binding of inducer protein to repressor protein     Gene is switched ON     Gene is…

A: Gene regulation is done with the help of the regulatory protein binding with the regulatory sequence…

Q: 18) MUTATIONS: A. Explain the difference between a point mutation and a frameshift mutation. B.…

A: Mutations are the gradual changes that occur in our DNA  sequence because of several factors such as…

Q: Describe the process of transcription in your own words, using the following terms: activator,…

A: The method of copying information from a strand of DNA into a new molecule of messenger RNA is known…

Q: Which of the followings statements are true about DNA polymerase? 1.) It can only go in one…

A: DNA polymerase is an enzyme that plays a key role in the replication of DNA. It catalyzes the…

Q: What is/are the attributes that make nucleotide excision repair (NER) and base excision repair (BER)…

A: Deoxyribonucleic acid (DNA) is a hereditary molecule that passes genetic information from one…

Q: utation rates than DNA viruses such as Herpes viruses? olymerases which copy viral RNA have much…

A: Viruses may be either composed of RNA or DNA. The Genome is surrounded by a protein coat called…

Q: Gene transcription/translation (circle one) is more complex than Gene transcription/translation…

A: There are four questions and I am answering the first question. According to Bartleby guidelines,…

Q: Unlike in prokaryotic cells,  transcription and translation in eukaryotic cells... Group of answer…

A: DNA is a polynucleotide strand that consists of a large number of nucleotides. Nucleotides consist…

Q: Which of the following is an example of positive control? (a) transcription occurs when a repressor…

A: A positive control is described as an integral part of an experimental that has a tendency to…

Q: a. Propose three different mutations to prevent initiation, elongation, and termination of bacterial…

A: Mutations: Mutations are caused due to alterations in the DNA sequence possibly affecting its…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.