Answered: How gene expression is controlled? (min…

Science

Biology

How gene expression is controlled? (min 500 words)

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter16: Gene Expression

Section: Chapter Questions

Problem 40CTQ: How can understanding the gene expression pattern in a cancer cell tell you something about that...

See similar textbooks

Related questions

Q: What is the expression platform?

A: The mRNA refers to the messenger RNA. It is a single-stranded RNA and is complementary to the DNA…

Q: explain gene targeting in embryonic stem cells?

A: Embryonic stem cells are characterized by the potency to generate different cell types and are…

Q: What are the eight ways gene expression can be regulated? Please summarize each in one-two sentences

A: There must be some sort of regulation on how much mRNA is translated into proteins after the DNA is…

Q: Determine Where and When Genes Act?

A: The structural unit of DNA is called a gene, which is responsible to transmit the inherited…

Q: b) Use the DNA sequence below to answer the following questions. 3'- TACGAACGAGTGCCCCAAAATT -5' What…

A: The process of converting DNA instructions into proteins is known as the central Dogma.

Q: page brief about the gene from genomics

A: The genome includes each the genes and also the noncoding deoxyribonucleic acid, furthermore as…

Q: What are transcription unit and the gene?

A: Transcription is the process by which the information in a strand of DNA (deoxyribonucleic acid) is…

Q: How DNA sequences lead to gene expression and, ultimately ?

A: Introduction Genome consists of DNA/RNA which consists of nucleotides either deoxyribose…

Q: What is a stem cell?

A: The fertilization of sperm and ovum results in a zygote which is diploid in nature. The zygote…

Q: Describe how specific molecules are used to change the gene expression of a gene in a cell. Explain…

Q: Insights with the stem cell 10 sentences.

A: Introduction: Stem cells are found in the very early stage of embryo and these are undifferentiated…

Q: What is the properties of stem cells?

A: Cells are the basic building units. They help to form a whole organism. These cells perform…

Q: What values are at odds in the controversy about the use of fetal stem cells in research?

A: Fetal stem cells come from embryos that are three to five days old. These contain raw materials in…

Q: What are transcription factors ?

A: Transcription factor: In molecular biology, a protein that controls the rate of…

Q: erm BEST describes the process of increasing mRNA production for a gene in response to a stimulus

A: The biological process by which the information encoded inside a DNA (deoxyribonucleic acid)…

Q: 28. How do regulatory gradients produce many different patterns of gene expression?

A: NOTE: since you have posted multiple questions. So we will be solving the first question for you. As…

Q: What is the difference between the different kinds of STEM cells?

A: Stem cells are self-renewal cell. They are undifferentiated cells that have the ability to divide…

Q: What are the two common characteristics of stem cells?

A: Two common characterstics of stem - cells are : Perpetual self - renewal. Ability to differentiate…

Q: How is the language of a gene expressed?

A: A gene is the functional unit that is inherited by an offspring from the parents. The total genetic…

Q: What are Transcribed Regions?

A: The term transcribed is related to the process of transcription. Transcription is one of the…

Q: What are the stages in gene expression?

A: The mechanism by which the information encoded in a gene is used to guide the assembly of a protein…

Q: Explain circadian rhythms in terms of gene expression.

A: " ANSWER Circadian rhythms Are powered with the aid of an intrinsic timing machine this is…

Q: s transcription specifically take place in the cell? s translation specifically take place in the…

A: Transcription - It is the process in which DNA is copied into RNA with the help of an enzyme RNA…

Q: How does the transcribed mRNA convert into a functional protein?

A: Introduction: Translation is the process by which ribosomes in the cytoplasm or endoplasmic…

Q: When & how genetic expression occurs ?

A: Genetic expression is the process in which the transfer of information occurs from DNA to proteins.…

Q: What is the debate about between President Bush and President Obama regarding Stem Cells?

A: Obama's move overturns an order signed by President Bush in 2001 that barred the National Institutes…

Q: Define gene locus

A: Gene is basic unit of heredity that is responsible for physical and functional activity.

Q: How gene conversion occurs?

A: Genetics is the branch of biology which deals with genes, heredity, and genome in the organism.…

Q: Name six different levels at which gene expression might be controlled.

A: The encoding of proteins by a gene that regulates cellular functions is known as gene expression.…

Q: What's the mRNA sequence? amino acid sequence?

A: Mutated DNA Sequence - TACGACCTTGGCGACGACT mRNA Sequence - AUG CUG GAA CCG CUG CUG A Amino Acid…

Q: Explain the flow of information during gene expression.

A: DNA is a pool of information. It contains all the information regarding all the proteins synthesized…

Q: How does the translated mRNA convert into a functional protein?

A: Translation is a process in which cells make the proteins.

Q: What are some uses of stem cells?

A: Stem cells are the types of cells that are having the property of self renewal and differentiation.…

Q: . What is meant by the phrase gene expression?

A: Gene - A gene is defined as a polynucleotide chain that consists of segments each controlling a…

Q: Why do scientists want to use stem cells?

A: The unique properties of the stem cells make them very important. Embryonic stem cells are normally…

Q: Stem cell What is the debate about between President Bush and President Obama?

A: A stem cell is a cell with the unique ability to develop into specialized cell types in the body. In…

Q: How do stem cells lose their ability to differentiate into any cell type?

A: Cell is the smallest structural and, functional unit of life. It is simple machinery that houses all…

Q: Does genetic change with the exercise?

A: Genetics refers to the study of the genetic makeup of the organism. genetics helps to study the…

Q: In which tissue(s) is the mRNA and protein highly expressed in? 1. Go to:…

A: As instructed in the above question steps were followed and tissue expression in terms of protein…

Q: What Control ElementsRegulate Expression ofthe mPGES-1 Gene?

A: The mPGES-1 gene in humans is responsible for encoding an enzyme involved in the synthesis of…

Q: How do cells control gene expression? How do cell "switch" genes on/off? Draw a flow chart to match?

A: The genes are regulated from time-to-time to make changes in the organisms. The way in which…

Q: Explain about Regulation of gene expression.

A: Introduction There are two key components which help in gene regulation Activators Repressors The…

Q: 1. Define gene expression. 2. Why must gene expression be regulated?

A: Gene expression is basically the expression of phenotype in an organism, using the information of…

Q: How do changes in gene expression relate to cell differentiation and specialization? Does every…

A: The DNA is the genetic material in most of the organisms including human. this DNA is transcribed…

Q: Anatomy of INS gene

A: The hormone insulin is required by the body to reduce the level of blood glucose. The pancreatic…

Question

How gene expression is controlled? (min 500 words)

Expert Solution

Step 1 Introduction

The genes are the components of the genome that direct specific functions in the cell. Their expression leads to the production of a protein that functions in specific metabolic pathways. Some genes are known as housekeeping genes as their expression is necessary for the basic functioning of all different types of cells.

Step by step

Solved in 2 steps

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Question: Define transcription and
Most disease associated genetic variants exist outside of gene coding regions, how are these thought to promote disease development? (300 word limit)
Direction: On the worksheet, all the DNA sequences run from 3' to 5'. Supply the corresponding amino acid base on the DNA sequence provided per item. Determine the type of mutation and explain its effect on the expression of amino acids. 1. DNA Sequence: TAC TCC GGC TCT CCC AGT TGA ACT inim Mutated Sequence: TAC TCG GCT CTC CCA GTT GAA CT Original Amino acid: Mutated Amino Acid: What mutation have occurred in the sequence? How does it affect the expression of amino acids? 2. DNA Sequence: TAC TCC GGC TCT CCC AGT TGA ACT Mutated Sequence: TAC TCT GGC TCT CCA AGT TGA ACT ww mm Original Amino acid: Mutated Amino Acid: What mutation has occurred in the sequence? How does it affect the expression of amino acids?
Please read and answer all questions. Please do fast!
For the P53, create a one page brief about the gene from genomics perspective.(just 250 word)
(Grade 12 Genetics) #1 UUU CCU AGU GGU #2 UUC CCA AGC GGC #3 UUC CCG AGA GGA Despite the fact that one of the mRNA sequences above codes for a different protein, it IS possible that it will be translated into the same protein as the other two. Explain how this might happen.
09 Explain the RAAS mechanism. ?
How gene expression is controlled?
Determine the membrane potential inside the cell and its unit of expression.
Q11: You are comparing the process of RNA splicing in an mRNA from normal and mutant cells of the same tissue. You find that the mutant mRNA is longer than the mRNA from the normal cells. Examination of the sequences of the gene encoding this mRNA reveals that there are nucleotide changes at the boundary of one of the exons in the mutant cell gene. Which of the following nucleotides would be expected to be found at the 3' end of upstream donor exons and the 5' end of downstream acceptor exons in the normal gene but not in the mutant gene? A. AG-G B. AG-AG C. CA-GA D. G-AG E. CG-G
Explain the RAAS mechanism.?(short answer)
The process of gene expression involves: