Use the codon chart to translate the following MRNA transcript into a protein. Please format your answer in this way Seond letter UGU UGC UAA Stop UGA Stop A UAG Stop UGG Trp G UUU UCU UCC UCA UCG UAU Tyr UAC U Сув C Phe u UUC UUA Leu Ser UUG CCU CUU CỤC CUA CUG CGU CGC CAU His CAC Leu Pro Arg CCA CGA CGG CAA Gin CCG CAG AUU ACU AAU Asn AGU AGC Ser AUC AUA AUG Met ACG lle ACC AAC Thr AAA AAG Lys AGG ACA AGA Arg GCU GCC GCA Ala GUU U GAU Asp GGC GAC GGU GUC Val GUA Gly GAA GGA GGG Glu GUG GCG GAG AUGCCUGGACAUUUUCAAGUAUAA HTML Editor BIUA- A- IEZ 3 x, 三 三 V G+ V D I T 12pt Paragraph First letter Third letter

Q: 1. What is a codon? 2. For eaxh of the following mRNA codons, give the tRNA anticodon and determine…

A: Central dogma of cell comprises of two important processes. They are transcription of DNA into mRNA…

Q: Please help me find the protein sequence in reference to the text below.      "mRNA Sequence…

A: Cell is the basic structural and functional unit of life. The nucleus in the cell contains the…

Q: If the DNA gene reads AAT GGT CCA CCG CTG, what will the MRNA read? O A. TTA CCA GGT GGC GAC O B.…

A: DNA is a macromolecule and is composed of nucleotides having sugar , phosphate and nitrogenous bases…

Q: Orignal MRNA sequence: UCA ACA O GCA UAA AGU

A: Question - Original mRNA sequence : UCA Options -    ACA  GCA UAA AGU

Q: In the diagram below, identify the mRNA by clicking on the correct highlighted portion. TACGGGCTA A…

A: Alleles are considered as the variant of the gene. DNA is composed of different nucleotides that…

Q: Complete the tables below to determine the polypeptide chain of a functional and mutated hemoglobin…

A: 1st Six Codons of the Functional Hemoglobin Gene... DNA.. GTG CAC CTG ACT CCT GAG  mRNA codon is ..…

Q: Using the Genetic Code Table in Figure 1.3, what is the proper sequence of amino acids in the…

A: DNA ( Deoxyribonucleic acid ) is two stranded ladder like structure which act as genetic material in…

Q: The following is part of the non-template strand of DNA for a gene. 5'-TACTATCATGAGAGATAGGAG-3'…

A: Transcription is the process by which the information in a strand of DNA is copied into a messenger…

Q: Directions: Transcribe the mutated DNA sequence in the space provided. The BOLDED nitrogen bases are…

A: Condon is the trinucleotide nitrogenous bases that codes for specific amino acids and there are in…

Q: Separate the following strand into codons: UGAAUUAUCGCG Your answer

A: Each codon is made up of three nucleotides, each of which corresponds to a single amino acid. The…

Q: Below is the template DNA sequence for an entire (short) gene that contains no introns. TRANSCRIBE…

A: The Central Dogma of Biology  DNA --(Transcription)-- RNA --(Translation) -- Protein  It says that…

Q: Shown below is the " sense" strand of DNA. Second letter U What is the amino acid sequence that…

A: Introduction :- Deoxyribonucleic acid (DNA) is a molecule made up of two polynucleotide chains that…

Q: TRANSLATE this RNA sequence: AUGCAAUGA Met-Gln-Stop Met-His-Stop O Thr-Glu-Stop O Thr-Pro-Stop

A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question…

Q: How many open reading frames are present in the following mRNA sequence? You may find the codon…

A: An open reading frame in molecular genetics describes the part of your reading frame that has the…

Q: give the amino acids specified by the following bacterial mRNA sequences. a. 5′…

A: In the given question, the bacterial mRNA sequence is given for which we have to find the amino…

Q: Original DNA Sequence = TACACCTTGGCGACGACT MRNA Sequence ATGGAACCGCTGGTGA Amino Acid Sequence = U…

A: Mutations occur when there is a change in the DNA sequence. The minor change in the DNA sequence can…

Q: How long is the polypeptide produced from the following mRNA transcript?…

A: We can find this answer using a codon chart- 5-UCA UGC UUG GAC UCA AGU CUA CGU GAA U-3' As each mRNA…

Q: If mRNA is UUACGC what is the DNA? Read from right to left. O TGCATT O UGCATU O TTUCGC UCGUTT AATGCG

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: Below is a short segment of DNA molecule. transcribed the DNA codon into mRNA.…

A: Convertion of TACCATGAGAATTGTGGTCACCTTTTT ATGGTACTCTTAACACCAGTGGAAAAA to mRNA is done and results…

Q: Translate the following mRNA codons: 5' AAG UGG CAU ACG - 3' Write your answer in order (first codon…

A: Translation in molecular biology is the process by which the RNA of the cell is read and comment…

Q: CUGACUGACUGA A template strand of DNA in a gene reads: TGG CTG GGT GCT ACA. GUCAGUCAGUCA Using the…

A: Firstly DNA template strand undergoes transcription process to form RNA. After that translation…

Q: Here is a DNA sequence that codes for an extremely short protein. 3' TТАССТССССАТССАА 5' template…

A: DNA acts as the template for mRNA synthesis. The mRNA has the same sequence as the coding strand of…

Q: 3. Using your Genetic Code, translate and group the following MRNA bases. Example: UAC CAG UGG UUU…

A: a. 5 'CUC GGU ACG UAA UAG AUC UAU CAU CCG AGA CUC UUA AAU 3' ANSWER:  5' Leu Gly Thr Stop Stop Ile…

Q: Complete the table below: DNA DNA Complimentary Strand  mRNA sequence  tRNA sequence  Amino…

A: Deoxyribonucleic acid is a molecule composed of two polynucleotide chains that coil around each…

Q: If my final mRNA product sequence is this: CAAGAUGUACUUUGCGACAAGAGAGGAUCCCAUCUGUGCGACUUGAACG What…

A: The central dogma of life states that there is a unidirectional flow of information from master copy…

Q: A mRNA contains a codon with the sequence 5'-UAC-3'. What would be the most likely sequence of the…

A: tRNA read out m-RNA and synthesize polypeptide chain with the help of ribosome.

Q: Please help transfer CAT AGG GAG to mRNA

A: Answer. DNA replication is a process that takes place inside the nucleus of the cell. During…

Q: What potential polypeptides can be produced from the following mRNA sequence? There are more than…

A: In our body genetic information is stored in form of DNA. DNA multiples itself by replication. DNA…

Q: Transcribe the following DNA molecule into mRNA.  Make sure to find the start codon to begin your…

A: A start codon initiates the transcription while stop codon terminates the transcription process.

Q: Complete the complementary strand: mRNA transcription ATTCGAGGCTAA

A: The ribonucleic acid (RNA) molecule involves the transfer of the genetic information from the…

Q: From TAC CTA CTC TAG TTA ACC ACA GTT GCC ATC. Translate the mRNA sequence.

A: The givem template sequence is as follows,  TAC CTA CTC TAG TTA ACC ACA GTT GCC ATC Template strand…

Q: Write down the complementary mRNA sequence for each of the following DNA sequence. A:…

A: If template sequence of the DNA is A..   mRNA is .. AUGGAUCGCGUGUACAUCCACCCGUUUCAA

Q: decode the following mRNA strand into the appropriate amino acid sequence (assume the first 3…

A: m-RNA undergoes translation to form proteins. The correct form of the amino acid sequence is 5’- AUG…

Q: TAC TGA TCG ACC CCC ATA ATG AAAAIC MRNA TRNA AA

A: The given sequence is anti-sense strand of the given gene. The anti-sense strand is in the direction…

Q: Second letter A G UUU Phenyl- UUC alanine UAU UAC UGU UGC Oysteine UCU Tyrosine UCC Serine UUA UUG…

A: The genetic codon present in the mRNA will be translated during the translation process by ribosome…

Q: Need help to answer the following questions. Not sure if my answers are right.

A: DNA has a double helix structure. Both the strands are antiparallel that is if the one strand has 3'…

Q: If DNA segments changes from GCATAG to GCATGG, this is a: MRNA Codon/Amino Acid Chart First Base…

A: The DNA sequence GCATAG will have the mRNA code CGUAUC. When the sequence changed to GCATGG, then…

Q: A segment of mRNA produced by the normal order of DNA nucleotides and the corresponding amino acid…

A: Introduction   Genetic code or codon is a three nucleotide sequence present on mRNA. It gives the…

Q: A. Below is a small 2 exon long gene. The exons are underlined, and the 22 nucleotide long intron is…

A: Given is a DNA template with a sequence and it consists of two exons and introns in it.Exons are the…

Q: A. Below is a small 2 exon long gene. The exons are underlined, and the 22 nucleotide long intron is…

A: "Since you have posted a question with multiple sub-parts, we will solve the first three sub-parts…

Q: 1. Below is the sequence from the 3' end of an mRNA.…

A: Genes store genetic information in the form of DNA, which may be converted into functional proteins…

Q: The following DNA strand is bound to transcription and translation. Give the translated 5-letter…

A: The nucleic acid polymer has nucleotide as its monomeric unit. synthesis of nucleotide…

Q: A Section of a Gene AAG ATA CAG GCT CGG TAA For the DNA sequence shown above, identify the…

A: \protein synthesis in a cell is a very important function. The information for protein synthesis is…

Q: Here is a DNA sequence that codes for an extremely short protein. 3' TTACGTGCCGATCGAA 5' template…

A: "Genes" are the fundamental unit of heredity. They store genetic information in the form of DNA,…

Q: Using the genetic code below, decipher the following mRNA sequence.…

A:

Q: Below is a small 2 exon long gene. The exons are underlined, and the 22 nucleotide long intron is…

A: Untranslated regions are present in RNA which are transcribed but not translated on either end of…

Q: This question refers to the mRNA sequence below: 5'-CCGUAUGCAUUUC GGACUUAGUAAGGACUGACAUA A-3' As…

A: The mRNA is produced from the DNA template strand by the transcription process. This mRNA contain…

Q: CUGCUGUGCAGAUGCUGGACG

A: A missense mutation occurs when there is a mistake in the DNA code and one of the DNA base pairs is…

Q: Transcribe the corresponding mRNA strand from the given DNA strand:    DNA:     TAC       GCA…

A: BASIC INFORMATION DNA It stands for deoxyribo nucleic acid.  It is the genetic material of all…

Q: The following set of RNA is required the translation process except one, mark the INCORRECT? * O a)…

A: Translation is the process by which the synthesis of protein occur.  Cells are the basic unit of…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.