Here is a DNA sequence that codes for an extremely short protein. 3' TТАССТССССАТССАА 5' template strand 5' AATGCACGGCTAGCTT 3' non-template (or 'coding') strand a. Transcribe it to mRNA (write your answer in the text box with no spaces and starting at the 5' end of the MRNA, like this: ccaggcaa.) b. Using the reading frame that begins with a start codon, what polypeptide will this MRNA produce? (write your answer using the three letter amino acid codes, separated by a hyphen but without spaces, like this: phe-leu-thr-ser.) Second MRNA base A G UUU UCU UAU UGU Tyr Cys Phe UUC UC UAC UGC Ser UUA UCA UAA Stop UGA Stop Leu UUG UCG UAG Stop UGG Trp CU CCU CAU CGU His CUc c CAC CC Leu Pro Arg CUA CCA CAA CGA Gin G CUG ccG CAG AUU ACU AAU AGU Asn Ser AUC lle ACC AAC AGC C. Thr AUA ACA AAA AGA Lys Arg AUG Mt or start ACG AAG AGG GUU GCU GAU GGU Asp GUC G GCC GAC GGC Gly GGA Val Ala GUA GCA GAA Glu GUG GCG GAG GGG First MANA base (5' end) Third MRNA base (3' end)

Here is a DNA sequence that codes for an extremely short protein. 3' TТАССТССССАТССАА 5' template strand 5' AATGCACGGCTAGCTT 3' non-template (or 'coding') strand a. Transcribe it to mRNA (write your answer in the text box with no spaces and starting at the 5' end of the MRNA, like this: ccaggcaa.) b. Using the reading frame that begins with a start codon, what polypeptide will this MRNA produce? (write your answer using the three letter amino acid codes, separated by a hyphen but without spaces, like this: phe-leu-thr-ser.) Second MRNA base A G UUU UCU UAU UGU Tyr Cys Phe UUC UC UAC UGC Ser UUA UCA UAA Stop UGA Stop Leu UUG UCG UAG Stop UGG Trp CU CCU CAU CGU His CUc c CAC CC Leu Pro Arg CUA CCA CAA CGA Gin G CUG ccG CAG AUU ACU AAU AGU Asn Ser AUC lle ACC AAC AGC C. Thr AUA ACA AAA AGA Lys Arg AUG Mt or start ACG AAG AGG GUU GCU GAU GGU Asp GUC G GCC GAC GGC Gly GGA Val Ala GUA GCA GAA Glu GUG GCG GAG GGG First MANA base (5' end) Third MRNA base (3' end)

Name: Here is a DNA sequence that codes for an extremely short protein.3' T
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Here is a DNA sequence that codes for an extremely short protein.3' TTACGTGCCGATCGAA 5' template strand5' AATGCACGGCTAGCTT 3' non-template (or 'coding') stranda. Transcribe it to MRNA (write your answer in the text box with no spaces and starting at

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 16QP: Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also,...

See similar textbooks

Similar questions

Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
Your labmate gives you a gene with the following sequence of the coding strand for the first 5 amino acids: 5'-ATGTCGTATCCCCGG-3' a. What is the sequence of the mRNA? Write your answer 5' to 3', but do not label ends. b. What is the encoded pentapeptide? Please write your answer in the form of: Pro-Thr-Asn c. You sequenced your labmate's provided gene, and found the following sequence: ATGTCATATCCGCGG. Will your labmate get their protein of interest from this sequence? (Yes or No?)
Below is a double stranded DNA that contains an ORF. Identify the ORF and in the spaces below, first provide the mRNA sequence that would result (in the 5' to 3' direction). Then give the protein sequence this mRNA would encode (in the N to C direction using the 3-letter abreviations and a single space in between). 5'-CTGCGC TAGGCGCAGTAGGGCATCCCACGACA-3' 3'-GACGCGATCCGCGTCATCCCG TAGGG TGC TGT-5' Codon Table: บบบ UUC JUA UUG CUU CUC CUA CUG Phe GUU GUC GUA GUG Leu Leu AUU AUC lle AUA AUG Met Val mRNA sequence: UCU UCC UCA UCG protein sequence: CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala UAU UAC UAA UAG CAU CAC CAA CAG Tyr Stop GAU GAC His Gin AAU Asn AAC AAAG} LUS Asp GAA GAG} Glu UGU Cys UGC UGA Stop UGG Trp CGU CGC CGA CGG AGU AGC Arg Ser AGG} Arg GGU GGC GGA GGG (DO NOT include the 5' and 3' numbers or the N and C. Write only the nucleotides and the abreviations for the amino acids. Include no spaces in the mRNA and a single space in between the amino acid…
Answer the following whether it is TRUE or FALSE: 1. For each DNA segment 3'-ACCTGCCTACCCG-5' the sequence of the mRNA molecule synthesized is 5'-TGGACGGATGGGC-3' 2. In the template strand TACCGAGGTATGTAC, the coding strand is 5'-ATGGCTCCATACATG-3'. 3. In the template strand TACCGAGGTATGTAC, the coding strand is 5'-AUGGCUCCAUACAUG-3'. 4. The template strand is the strand of DNA used for RNA synthesis. 5. Transcription forms a messenger RNA molecule with a sequence that is identical to the DNA template from which it is prepared.
Given the following DNA sequence of the template strand for a given gene: 5' TTTCCGTCTCAGGGCTGAAAATGTTTGCTCATCGAACGC3' Part A ) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends). Part B ) Use the genetic code to write the peptide sequence translated in a cell from the mRNA in part A. Please use the 3 letter abbreviation for each amino acid. Part C: How would the peptide synthesized in a cell be different if the mRNA was translated in vitro (i.e. not in the cell)?
Choose one of the strands and transcribe the strand. Show the steps (with proper label) and do a post transcriptional processing Once the transcript is made, do the process of translation. Again follow the steps. Use the Wobble Table for reference 5’ CTATATTTATGTGCTATATCCAGGACTGCCCCTAGGAAATAAAAAA…AAAAAAA 3’3’ GATATAAATACACGATATAGGTCCTGACGGGGATCCTTTATTTTTT…TTTTTTT 5’
Below is the DNA sequence of a patient with overlapping genes (a single mRNA has multiple initiation points for translation) for two different proteins (DADαs and AMA): 5’- GTCCCAACCATGCCCACCGATCTTCCGCCTGCTTCTGAAGATGCGGGCCCAGGGAAATCTCTAACG-3’ 1. Indicate the DNA sequence coding for RNA. 2. Indicate the amino acid sequence of each of them.
Given the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' where N stands for any nucleotide, give the complementary mRNA sequence. Indicate direction of strand as 3'--> 5' or 5'--> 3' as in the given sequence above. Give the amino acid sequence of your mRNA sequencelin No. 1. Indicate direction of strand as above. Use all lowercase letters, 3-letter name of amino acid separated by a hyphen (-), no spaces in-between.
Using the provided coding strand below: 5-ATCAGATGGCCGGGCCAATAGAATAGCTGT-3 Provide the mRNAstrand for the coding strand above. Type your answer in the box below. Use two dash lines in between the 5 and your first base, and two dash line between your last base and before 3' (follow formatting above). What is your Start codon? What is your Stop codon? 5-AUGGCCGGGCCAAUAGAAUAG-3 AUGGCCGGGCCAAUAGAAUAG
For each of the following items, fill in either the DNA strand, the MRNA codons, the tRNA anticodons, or the amino acid sequence that have been left blank. If several sequences might work, choose only one. Furthermore, circle the start and the stop codons of each mRNA sequence. 1. DNA (3'-5') ACG TAC GGC CGG TTA AAG CAT ACT TTC TTG MRNA TRNA Amino Acid 2. DNA (3'-5') MRNA AUG ACU AGC UGG GGG UAU UAC UUU UAG AAA TRNA Amino Acid 3. DNA (3'-5') MRNA TRNA GCU CCU UAC CAC ССС CGU AUG GCU GGG AUC Activate Go to Sett Amino Acid
Given the DNA sequence below: 5’-ACATGTGTACAGGCTTTGTCTGAATGGCTT-3’ 3’-TGTACACATGTCCGAAACAGACTTACCGAA-5’ Transcribe the gene. (Write the primary structure of the mRNA that will be produced.)
The sequence below shows the non-coding strand from the whole of the transcribed region of a very short gene. 5’-GGCTTCTTTAGTACTGGCCAGTGGGATCCAAGTAGGCTGCCATTTCGT-3’ Write out the sequence of the mRNA from this gene in the orientation 5′ → 3′ and, using the genetic code (see Fig. 1. overleaf) deduce the amino acid sequence of the peptide it encodes (NB you should read about the operation of the genetic code prior to attempting this question).