Please help transfer CAT AGG GAG to mRNA

Q: c) Give an account of how messenger RNA (mRNA) is produced in the cell nucleus (transcription) and…

A: Hoe mRNA is produced in cell nucleus : in molecular biology messenger RNA ( ribonucleic acid  ) is a…

Q: Explain why RISC binds to a specific mRNA. What type of bonding occurs?

A: The gene expression regulation in a cell to inhibit the expression of particular genes is called…

Q: The amino acid sequence of human vasopressin is Cys-Tyr-Phe-Gln-Asn-Cys-Pro-Arg-Gly. Write an mRNA…

A: The given amino acid sequence of human vasopressin is Cys-Tyr-Phe-Gln-Asn-Cys-Pro-Arg-Gly.  3…

Q: sgRNA GFP Exon 1 Exon 1 Intron 1 Exon 2 Exon 2 Intron 2 Exon 3 Intron 3 Exon 4

A: Messenger RNA (mRNA) is a cellular component that transports instructions from DNA in the nucleus to…

Q: Briefly explain the importance of the protein factor EF-Ts in the translation process. Do not simply…

A: After the process of transcription of DNA to RNA in the nucleus of the cell, ribosomes in the…

Q: The woman undergoes hip surgery. If all of the arteries that are part of the cruciate anastomosis of…

A: The cruciate anastomosis is circular anastomosis of inferior gluteal artery present in upper thigh ,…

Q: Discuss the two steps involved in RNA processing. Please explain each step in 2-3 sentences only.

A: In Eukaryote, mRNA produced during the transcription process is known as pre-mRNA. They undergo…

Q: In the diagram below, identify the mRNA by clicking on the correct highlighted portion. TACGGGCTA A…

A: Alleles are considered as the variant of the gene. DNA is composed of different nucleotides that…

Q: Define transfer RNA (tRNA)

A: Ribonucleic acid [RNA] is single-stranded nucleic acids that are composed of a nitrogenous base, a…

Q: TRANSCRIBE THE GENE INTO mRNA:   TACCAGTTAGTCGTAGA

A: Transcription is process of copying a DNA segment into RNA.

Q: What are the functional consequences of this deletion for lilP mRNA transcription and translation?…

A: Introduction :- A deletion mutation is a type of genetic mutation that involves the loss of one or…

Q: Draw a general structure of a mature mRNA

A: mRNA is a single-stranded RNA that contains a genetic sequence and it encodes for a protein. It is…

Q: pre-mRNA maturation to mRNA involves a guanosine nucleotide that is not part of the RNA polymer…

A: Deoxyribonucleic acid, or DNA, is a molecule that holds the information that allows an organism to…

Q: The type of RNA modification that requires guide RNAs is ________.

A: Hi, Thanks For Your Question.  Answer : Correct Answer Is RNA Editing Explanation : RNA Editing Is…

Q: Small nuclear RNA from 50-200 bases that combine with proteins to form complexes capable of editing…

A: RNA editing is a post-transcriptional modification process that alters the sequence of RNA…

Q: An mRNA may contain the sequence ATTGACCCCGGTCAA True/False

A: RNA or ribonucleic acid is a polymeric molecule essential in various biological roles in coding,…

Q: Which of the following enzymes is NOT utilized in mRNA degradation? MARK ALL THAT APPLY Primase Poly…

A: Transcription: It is processed to convert DNA into RNA. It is part of the central dogma. It is…

Q: The tRNA molecule carries EIF2 and GTP and binds the small ribosomal subunit at the P site in the…

A: During the process of translation which is the synthesis of proteins from mRNA translation…

Q: CCGGTGTACACAGGGACCATTCGATTA What is the mRNA:? Protein Phenotype?

A: The sequence of a protein is usually notated as a string of letters, according to the order of the…

Q: Define Sense codon  as they apply to the genetic code

A: Sense codons are those codons which specify amino acids at the time of protein synthesis…

Q: Define messenger ribonucleic acid (mRNA)

A: Answer: Introduction: RNA molecule consists of four nucleotide bases these are adenine (A), cytosine…

Q: Translate the following mRNA sequence into the appropriate amino acid sequence.…

A: Messenger RNA is referred to as mRNA. It is a specific kind of RNA (ribonucleic acid) molecule that…

Q: Write TRUE or FALSE. If false, write the word/s that make(s) the statement incorrect. A glycosidic…

A: Similar to Deoxyribose Nucleic Acid(DNA), RNA(Ribose Nucleic Acid) is a linear polymer composed of…

Q: pre mRNA can be spliced in more than one way, permitting a single gene to produce multiple mRNAs…

A: Pre mRNA can be defined as a primary mRNA transcript,which is formed during transcription.This pre…

Q: Use the diagram below and match the correct options from drop-down menu on the right. P-site TRNA…

A: Translation is the process by which genetic information encoded in mRNA (messenger RNA) is decoded…

Q: In human, translation begins before transcription of an mRNA completes. T/F

A: The central dogma of molecular biology states that exciting DNA molecule in the cell undergoes…

Q: Capping of eukaryotic mRNA occurs at the 5' end O occurs at the 3' end O occurs at both ends O…

A: Transcription is the process by which the genetic information stored in the DNA is copied onto a…

Q: GENE TABLE 1: WILD-TYPE MC1R GENE (LIGHT COAT-COLOR PHENOTYPE) DNA GAA CAG GTG GTT CCA AAG…

A: The central dogma of life involves the following three steps. Replication: DNA replicates to make…

Q: e transfer-RNA and the amino acid structure attached to 5' 10

A: In molecular biology and genetics,translation is a process which comes after transcription and in…

Q: In Figure 9-12(b), what do you think happens to thetRNA that is released from the E site?

A: t-RNA is responsible to bring the amino acids to the site of protein synthesis. t-RNA is charged…

Q: Several ribosomes attached to one mRNA,which they are all transcribing, form acluster called a/an

A: The DNA (deoxyribonucleic acid) is the hereditary unit of an organism. It is passed on from one…

Q: Define RNA interference (RNAi).

A: RNA interference, also known as RNA silencing is a biological process that involves suppression of a…

Q: GGCACCTGCGATGCATGAATATATCGATCGGGAATCGCTATGTCAAGCCATGGCTAGATTA…

A: m RNA sequence is created by the enzyme called RNA polymerase that copies the nucleotides according…

Q: N' C' = Polypeptide X d a b = SRP 5'- = translocator e Which region(s) of polypeptide X would bind…

A: Ribosomes refer to the site where the protein synthesis takes place. It comprises rRNA and protein.…

Q: What are the differences between miRNA and siRNA? (Select all that apply.) OmiRNAs carry the genetic…

A:

Q: What will be the anticodon of the next tRNA added to the A site of the ribosome?

A: Codons are situated in on mRNA and anticodons are situated on tRNA.

Q: Transcribe and translate the RNA. AUG GAG CAU CCU UGG GCA GCC UUA

A: Transcription and translation Transcription is the process when the DNA is converted into RNA. and…

Q: Transcribe the gene to mRNA sequence and translate the mRNA gene to protein sequence.

A: Genes are sections of DNA which hold the information that are needed to make proteins. Transcription…

Q: Define the term RNAi.

A: Recombinant DNA technology (rDNA technology) is extremely useful for analyzing a species' entire…

Q: TOIC Stimulus EUkaryotic cell mi RNA Protein SUp nucleus Deg target mRNA:

A: The diagram illustrates an eukaryotic cell in which micro RNA binds to the target mRNA which has…

Q: The presence of a polyA tail in eukaryotic mRNA helps protect the mRNA from degradation. true/false

A: The poly-A tail is long chain consisting of adenine nucleotides which is added to mRNA molecule…

Q: Which of the following RNAs are required for translation? (Choose all that apply) tRNA rRNA…

A: Adenine, guanine, cytosine, and uracil make up RNA, which is a polymer of nucleotides composed of a…

Q: Describe how an Rna molecule is translated into a protein at the ribosome

A: The process of synthesis of protein from RNA is known as translation and occurs within a specialized…

Inheritance and Mendelian Genetics

Inheritance means the passing of traits to offspring from parents. These traits could be passed either through asexual reproduction or sexual reproduction. The offspring receives the genetic material from the parents. Mendelian inheritance is a certain biological inheritance that follows the rules and principles laid down by Gregor Mendel in 1865. The initial hypothesis was considered wrong, but other inheritance theories modified the concept of inheritance and thus genetics.