
Human Anatomy & Physiology (11th Edition)
11th Edition
ISBN: 9780134580999
Author: Elaine N. Marieb, Katja N. Hoehn
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
2. (True/False ) Inverted repeats are common features of transcription termination sequences in all three domains of life.
Expert Solution

This question has been solved!
Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.
Step by stepSolved in 2 steps

Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- 4. This is the same gene as #1, but with a mutation!! (C/G-T/A at base pair 33) a. Where in the gene is the mutation? (promoter, 5'UTR, 3'UTR, start codon, stop codon, coding region ...) b. Transcribe and translate the gene now What type of mutation is this? C. 5'- CAAATTAATGGCGGCATTTACGATGGTGGGATTATTACATTGACTAACG -3' 5 1 3'- GTTTAATTACCGCCGTAAATGCTACCACCCTAATAATGTAACTGATTGC -5' C. 1 -+ --+-- --+-- 5. This is the same gene as #1, but with a mutation!! (insertion of CG at base pair 29) a. Where in the gene is the mutation? (promoter, 5'UTR, 3'UTR, start codon, stop codon, coding region ...) b. Transcribe and translate the gene now What type of mutation is this? --+-- -+-- 51- CAAATTAATGGEGGO 5'- CAAATTAATGGCGGCATTTACGATGGTGCGGGATCATTACATTGACTAACG -3' 5 -+-- 1 -+- 3'- GTTTAATTACCGCCG 3'- GTTTAATTACCGCCGTAAATGCTACCACGCCCTAGTAATGTAACTGATTGC -5' -+-arrow_forward2. You perform a series of experiments on the synthesis of the pituitary hormone prolactin, which is a single polypeptide chain 199 amino acids long. In the first experiment, the MRNA coding for prolactin is translated in a cell-free protein synthesizing system containing ribosomes, amino acids, tRNAs, aminoacyl-TRNA synthetases, ATP, GTP, and the appropriate initiation, elongation, and termination factors. Under these conditions, a polypeptide chain 227 amino acids long is synthesized. In a second experiment, the MRNA is translated in the same cel1-free system to which you have added SRP. In this case, translation stops after a peptide about 70 amino acids long has been produced. In a third experiment, you use the same cell-free translation system to which you have added both SRP and endoplasmic reticulum vesicles, and you find that that the prolactin MRNA now produces a polypeptide that is 199 amino acids long. A) Explain these results.arrow_forward6. explain what coupled transcription-translation is, and why it occurs in prokaryotes but not eukaryotesarrow_forward
- 1. In the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotides in the amino-acid-coding region is represented by the sequence:3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand?arrow_forward3. In future lectures we will describe a technique known as Northern blotting that can be used to detect RNA transcribed from a particular gene. Briefly, in this method a specific RNA is detected using a short segment of cloned DNA as a probe. The DNA probe, which is radioactive, is complementary to the RNA that the researcher wishes to detect. After the radioactive probe DNA basepairs to the RNA, the RNA is visualized as a dark (radioactive) band on an X-ray film. As shown here, the method of Northern blotting can be used to determine the amount of a particular RNA transcribed in a given cell type. If one type of cell produces twice as much of a particular mRNA as occurs in another cell, the band will appear twice as intense. Also, the method can distinguish if alternative RNA splicing has occurred to produce an RNA that has a different molecular mass. 875 nucleotides 675 nucleotides 1 Northern blot 2 - 3 Lane 1 is a sample of RNA isolated from nerve cells. Lane 2 is a sample of RNA…arrow_forward1. What happens during transcription? Possible sentence frame: Transcription is the process in which the information from converted into This happens by isarrow_forward
- 3. A mutation was introduced to the original DNA and now you have following DNA sequence (the mutation is colored in red.). 5' -GGATGCATGCCCCTCAAAGGGTAAATT-3' (coding strand) 3' -CCTACGTACGGGGAGTTTCCCATTTAA-5' (template strand) What is going to happen to the protein coded by this gene? Write expected amino acid sequence (like Pro-Arg-Tyr-)arrow_forward7.What type of mutation occurred in the example above (question #6)? Did the polypeptide change? Why or why not?arrow_forward1. Retrotransposons are nonviral genetic elements that facilitate their own movement within the genome (true or false) 2. Most mRNA molecules have an indefinite lifespan allowing high quantity protein synthesis from a single mRNA molecule (true or false) 3. spliceosome is a complex of RNA and protein that catalyzes the removal of exons from pre-mRNA (true or false)arrow_forward
arrow_back_ios
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education

Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax

Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,

Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company

Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.

Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education