This is the same gene as #1, a. Where in the gene is the mutation? (promoter, 5'UTR, 3'UTR, start codon, stop codon, coding region ...) b. Transcribe and translate the gene now C. What type of mutation is this? 5'- CAAATTAATGGCGGCATTTACGATGGTGGGATTATTACATTGACTAACG -3' 1 5 3'- GTTTAATTACCGCCGTAAATGCTACCACCCTAATAATGTAACTGATTGC -5' --- ---- ———

Which DNA strand will serve as the template strand during the transcription of the RNA-coding sequence?

4) Shown below is a schematic drawing of a gene, with the transcription unit divided into numbered regions. The arrows indicate transcription initiation sites, "D" indicates a splice donor site, "A" indicates a splice acceptor site, and "An" indicates a polyadenylation signal. Indicate all the possible mRNAs that could be produced from this gene (you don't need to draw new schematics - just list the regions that would be included in each mRNA by number)

Sickle cell hemoglobin DNA CACGTAGACTGAGG ACAC.. Sickle cell hemoglobin MRNA Sickle cell hemoglobin AA sequence 4. What type of mutation is this? Please explain why.

Table of the Standard Genetic Code Middle base 5'- C_-3' UCU Ser (S) |UAU Tyr (Y) UCC Ser (S) UAC Tyr (Y) UCA Ser (S) UCG Ser (S)UAG Ter CCU Pro (P) CAU His (H) CCC Pro (P) CCA Pro (P) CAA GIn (Q) CCG Pro (P) CAG GIn (Q) 5'- _U -3' 5'-_A_-3' 5'-_G_-3' 5'-U_-3' UUU Phe (F) 5'-U_-3' UUC Phe (F) 5'-U_-3' |UUA Leu (L) 5'-U_-3' UUG Leu (L) 5'-C_-3' |CUU Leu (L) 5'-C_-3' |CUC Leu (L) 5'-C_-3' CUA Leu (L) 5'-C_ -3' CUG Leu (L) UGU Cys (C) 5'-_U-3' 5'-_C-3' 5'-_A-3' UGG Trp (W) 5'-_G-3' 5'- U-3' 5'-C-3' 5'-_A-3" 5'- G-3' 5'- U-3' 5'-_C-3' 5- А-3' 5'-_G-3' GCU Ala (A) GAU Asp (D) GGU Gly (G) 5'-_U-3' 5'-C-3' GGA Gly (G)5'-_A-3' GGG Gly (G) 5'-_G-3' UGC Cys (C) UGA Ter UAA Ter CGU Arg (R) CGC Arg (R) CGA Arg (R) CGG Arg (R) ACU Thr (T)|AAU Asn (N) AGU Ser (S) AAC Asn (N) AGC Ser (S) AGA Arg (R) AGG Arg (R) CAC His (H) 5'-A_-3' |AUU lle (1) 5'-A_-3' AUC Ile (1) 5'-A_-3' |AUA lle (1) 5'-A_-3' |AUG Met (M) ACG Thr (T) AAG Lys (K) 5'-G_-3' GUU Val (V) 5'-G_-3' GUC Val (V) 5'-G_-3' GUA Val (V)…

a. How do bacteria increase the efficiency of gene expression? Is this possible in eukaryotes? b. A mutation in the promoter of Gene K disrupts an enzyme binding site and results in the loss of Gene K expression. Is this change in gene expression likely happening at the transcriptional or the translational level? Explain. c. Propose three different mutations to prevent initiation, elongation, and termination of bacterial transcription, respectively. Explain how/why each mutation would prevent its respective step. (Hint: mutations can be in genes that encode proteins or regulatory DNA sequences)

Choose the item in column 2 that best matches each item in column 1. A. Provides information for production of protein B. Binds to promoter C. Promoter has a box A and box B consensus sequences D. Autocatalytic RNA molecules E. Associated with transcription termination F. Polymerization of ribonucleotides to form RNA molecules G. 7-methyl guanosine H. MRNA prior to processing select - 1. Core RNA polymerase select 2. rho (p) factor select 3. hnRNA select - 4. RNA select -5. RNA polymerase holoenzyme select 6. Ribozymes select - 7. 5' MRNA cap select 8. MRNA

1d) What amino acid would a tRNA with the anticodon 5'AGG3' carry?