a. Below is a portion of a bacterial chromosome that contains a gene. The promoter region and the +1 base pair are indicated, as well as the direction (5' and 3') of the two DNA strands. +1 -10 -35 .3'тTGCATCСGAAАCGTACGATCGATCEGCCGACTТАТТАСGATCGGACTAФTGCGTCсТAGC5'... ...5'AACGTAGGCTTTGCATGCTAGCTAGCCGGCTGAATAATGCTAGCCTGATGACGCAGCATCG3'.. (i) Write the first 12 nucleotides of the RNA molecule transcribed from this gene. Be sure to indicate the 5' and 3' ends from left to right of the RNA strand. (ii) Explain why the Start codon does not appear in the first three nucleotides of the sequence transcribed in (i). 2.

A. Diagram a short single strand of DNA 5’ -AA-GG- 3’. Show the chemical structure of the phosphoribosyl backbone and the attachment point for nucleotides added as “A” or “G”. B. Diagram the product of digestion was a restriction enzyme to cut this sequence between the A and G.

Both question correlate with each other

Please in detail, what the picture attached represents

Below is a portion of an exon from a gene that encodes protein X in the genome of the plant Arabidopsis. Wildtype DNA3’ TTC  AAT GCT CCG AAT ACC 5’ template strand5’ AAG TTA CGA GGC TTA TGG 3’ non-template strand A new strain (Strain B) of Arabidopsis is identified with the same region of the gene coding for protein X: 3’ TTC  AAT GCT CCC AAT ACC 5’ template strand5’ AAG TTA CGA GGG TTA TGG 3’ non-template strand Compare the two DNA sequences and look for any differences. Based on what you find   a. There is no mutation in Strain B compared to Strain A. b. After the point of the mutation, all the amino acids encoded by the Strain B template will be different than the Strain A protein X. c. Protein X made from the Strain B template will be much shorter than protein X made from the Strain A template d. Protein X from Strain B will have one amino acid difference that would not affect protein function. e. There is a mutation but there will not be any difference in the…

E The arrow in the diagram below indicates the direction of transcription. BTTL c. A ATGCCGCA AUGCCCCAAUCUG TACGGCGTTAGAC OA OB с Q Search Which letter indicates the 5' end of the DNA template strand? R F TTCACGCACTCATSTOFACCACGTA T G Direction of synthesis- CG STACATGAGIAC LOC Y H Krit & 7 FO U 99+ * 8 D ATEGTGCAT CVBNM MO DE 79 Alt F:-10 KL E 0 P ^ @ ¹ F12 Ctrl 10:37 AM 4/8/2023 10