a. Below is a portion of a bacterial chromosome that contains a gene. The promoter region and the +1 base pair are indicated, as well as the direction (5' and 3') of the two DNA strands. +1 -10 -35 .3'тTGCATCСGAAАCGTACGATCGATCEGCCGACTТАТТАСGATCGGACTAФTGCGTCсТAGC5'... ...5'AACGTAGGCTTTGCATGCTAGCTAGCCGGCTGAATAATGCTAGCCTGATGACGCAGCATCG3'.. (i) Write the first 12 nucleotides of the RNA molecule transcribed from this gene. Be sure to indicate the 5' and 3' ends from left to right of the RNA strand. (ii) Explain why the Start codon does not appear in the first three nucleotides of the sequence transcribed in (i). 2.

Q: The following is the base sequence of DNA that codes for first eight amino acids of the β chain of…

A: As per the bartleby guidelines experts are allowed to answer only 3 sub-parts for a question. The…

Q: For the following sequence design the forward and reverse primer... explain and justify your answer.…

A: A primer is a short, single-stranded DNA or RNA sequence that initiates DNA synthesis. In PCR,…

Q: please answer the question provided in the picture about the black allele gene asap please

A: INTRODUCTION Translation is the process of translating the sequence of a messenger RNA (mRNA)…

Q: What are the particular changes in the gene and protein sequences shown on the screen? Name the…

A: Mutation is the sudden change of a gene or chromosome from one to another. position 3 wild type…

Q: 1 tctagagtca tgaaacaaca aaaacggctt tacgcccgat tgctgacgct gttatttgcg 61 ctcatcttct tgctgcctca…

A: Forward Primer:5'-TCTAGAGTCAATGAAACAACA-3'Explanation:This sequence starts with the same…

Q: What are the functional consequences of this deletion for lilP mRNA transcription and translation?…

A: Introduction :- A deletion mutation is a type of genetic mutation that involves the loss of one or…

Q: For the chromatogram below, what is the sequence of the template DNA from base 115 to 125?…

A: According to the question, we have to answer the question that which is for the chromatograph below,…

Q: The beginning of the hexose kinase gene's sequence can be found below, the +1 nucleotide is…

A: The ds DNA strand between position 20-30 3'- GATACGCGATG- 5' The sequence of primer that will be…

Q: Design primers that will amplify the following region of DNA (assume this is one strand from a…

A: The forward primer is designed to anneal to the template DNA strand at the 5' end of the target…

Q: What will be the mRNA produced from the given template? DNA Template 3 - ATTGCGGATGCCCGTATACG -5 DNA…

A: There are two types of nucleic acids, DNA and RNA. Nucleotides are the building blocks of nucleic…

Q: Based on the sequence data in the figure above, would you consider the patient to be not affected,…

A: Based on the information provided in the figure above, it can be concluded that the patient is…

Q: The restriction enzymes KpnI and Acc65I recognize and cleave the same 6 bp sequence. However, the…

A: Restriction enzymes are specific endonucleases that are responsible for cutting double stranded DNA…

Q: Restriction enzyme:   Recognition sequence:     Number of pieces of DNA:  Type of cut:

A: In the question a DNA sequence is given with its nucleotides.  Restriction enzyme is an enzyme that…

Q: The most common MCAD mutation is shown below. The coding strand is shown for both the WT and mutant.…

A: 5’ATGGCC[TATAT]ATGTCACTTGACTACGCAGCC[GCCACCATGG]ATATAGATAATGCGCGCATAGCATACTGAGGGTAGTAG-3’…

Q: Part A The bacterial gene little protein (lilP) makes a small protein of 11 animo acids (AA) in…

A: Introduction :  The translated form of the DNA sequence is the amino acid sequence. The DNA sequence…

Q: 5 5 S 6 5 5 5 6 U 6 U 6 5:14 PM | 0.2KB/s HHHHH R R U RUUR ARU AP AP R U U R R AP R R R AP…

A: Transcription is the process of formation of mRNA from DNA template strands by an enzyme called RNA…

Q: A mutation was introduced to the original DNA and now you have following DNA sequence (the mutation…

A: A mutation is the change in the genetic material of an organism. A point mutation is the mutation…

Q: a. Assume that replication has been initiated at that ORI. Provide the sequence of the primer that…

A: DNA is the genetic material of almost all living organisms. It contains information that is…

Q: What restriction enzyme (or enzymes) would you use to cut the following...   (Gene of Interest is…

A: Forward Primer:5'-TCTAGAGTCAATGAAACAACA-3'Explanation:This sequence starts with the same…

Q: 1. Give the complete complimentary bases of the parent DNA strand according to Chargaff's rule and…

A: DNA is a deoxyribonucleic acid. It is the double helical molecule which carries genetic information…

Q: GIVEN THE FOLLOWING DNA SEQUENCES (+) OF THE GENBANK: INDICATE WHICH IS THE TEMPLATE MOLECULE, WHICH…

A: The template strand extends from 3' to 5'. The coding strand, that extends from 5' to 3' in…

Q: You are studying a protein that contains the peptide sequence RDGSWKLVI. The part of the DNA…

A: The restriction endonuclease are responsible for cutting the DNA at specific sequence and they…

Q: Based on the following wild type DNA sequence, indicate if each of the mutations should be…

A: A mutation is a change in a DNA sequence. Mutations can result from DNA copying mistakes made during…

Q: The coding sequences of Gene F and Gene G are shown by the double-stranded DNA below. Using the…

A: Genetic codes are stored in the form of trinucleotide sequences (codons) in the mRNA.The mRNA gets…

Q: Decide on two restriction sites that you can use to clone this into pL4440’s MCS. Identify their…

A: DNA cloning restriction sites are specific DNA sequences recognized and cleaved by restriction…

Q: 2a. Assume that replication has been initiated at that ORI. Provide the sequence of the primer that…

A: AT GC base pairing: In double stranded DNA, the guanine (G) base on one strand can form three…

Q: Which of the following represents the sequence of an RNA transcript for which the coding strand…

A: A DNA molecule is a double-helical structure.

Q: ure 1 is a bacterial gene (1-180). The first base to be transcribed is the base located at sition…

A: Transcription is a process in which RNA is formed with the help of template strand of DNA. It…

Q: Part of a gene is written below, and transcription begins at the boxed T/A base pair and proceeds…

A: Gene is present on a chromosome and contains hereditary information. These genes are later…

Q: The beginning of the hexose kinase gene's sequence can be found below, the +1 nucleotide is…

A: Information of any DNA molecule is present in its sequence of bases on two strands. When cell…

Q: You have the following DNA sequence: 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and…

A: “Since you have posted multiple questions, we will provide the solution only to the first question…

Q: If the promoter is here and transcription starts here…

A: Transcription is the process of formation of RNA using DNA as a template.

Q: What conditions would we find on the gene of a prokaryote if there is low amounts of tryptophan…

A: Tryptophan is less common amino acid found in protein. They plays an important role in structural…

Q: a. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS…

A: DNA replication is a phenomenon in which DNA make itself using Enzyme DNA Polymerase . It occurs in…

Q: In which strand is the promoter? 5' TCATGAGATA GCCATGCATA TCTAGTATGT AGGCATCTGA GTTTATATCT CA 3' 3'…

A: Phosphodiester linkages connect DNA strands, which are polymers or chains of deoxynucleoside…

Q: Give the RNA molecule sequence transcribed from the following DNA sequence of a eukaryotic gene and…

A: DNA stands fo deoxyribonucleic acid. It is the genetic material.

Q: Table I CAC GTA GACTGAGG ACTC CACGTA GACTGAGG ACAC Wild-type beta-globin gene fragment Sickle-cell…

A: Abrupt changes in the DNA sequence of nucleotides is called mutation. Even a single nucleotide…

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.