To verify the is indeed inside your plasmid, you'd like to do a colony PCR. But you need primers for your reaction. Which of the following primer pairs would probably work for verifying your insert is actually present in the plasmid? 5' ATGTTTATTTTCTTATTATTTTTTACTCTCACTAGTGGTAGTGACCTTGACCGGTGCACCACTTTTGATG ATGTTCAAGCTCCTAATTACACTCAACATACTTCATCTATGAGGGGGG TTTACTATCCTGATGAAATTTT (Very long, but a bunch of nucleotides her e)...... TCTTGCTTTGTTGCATGACTAGTTGTTGCAGTTGCCTCAAGGGTGCATGCTCTTGTGGTTCTTGCTGCAA GTTTGATGAGGATGACTC TGAGCCAGTTCTCAAGGGTGTCAAATTACATTACACATAA 3' Forward: 5' GGT AGT GAC CTT GAC CGG 3' Tm= 59.8 OA. Reverse: 5' CAA ATT ACA TTA CAC ATA A 3' Tm= 47.4 Forward: 5' ATG TTT ATT TTC TTA TTA TTT 3' Tm= 47.1 C OB. Reverse: 5' TAT GTG TAA TGT AAT TTG ACA CCC 3' Tm= 58.4 Forward: 5' GGT AGT GAC CTT GAC CGG 3' Tm= 59.8 Reverse: 5' GTG TAA TGT AAT TTG ACA CCC TTG 3' Tm: 59.4

Q: Which of the following pairs of sequences would be considered different alleles in DNA profiling?…

A: DNA profiling employs highly variable conserved regions known as variable number tandem repeats…

Q: Which of the following objects would you use microinjection in order to transfer DNA into? a. Egg…

A: Microinjection is the process of transferring DNA materials into a living cell. It can be done by…

Q: Given below is the DNA template. What are the gene products? 3’ TACCGGCCTATCTAGGGCCATGGCTTAATTCCC 5’…

A: DNA is the sequence of Nucleotides that are transcribed into mRNA during transcription. Once DNA is…

Q: The target sequence for a PCR amplification is shown below. When the final cycle of PCR has ended,…

A: The polymerase chain reaction (PCR), often known as "molecular photocopying," is a rapid and…

Q: You design primers that will amplify a 400 bp fragment of the CAT gene and perform PCR. The 400 bp…

A: PCR is a technique that helps in the amplification of a target gene or a specific region of DNA. The…

Q: How many microliters of the pGLO plasmid do you need if you want 5 micrograms of DNA and the plasmid…

A: formula used :  DNA in ug =  (concentration of DNA / pGLO plasmid in ug/ul) ×(volume of DNA in ul)

Q: You are interested in amplifying the putative gene encoding the 480-bp protein TMR (Total Memory…

A: We are given with the gene that is needed to be amplified by PCR. The image shows a region of DNA…

Q: You are studying a new plasmid, and you digest the plasmid with three restriction enzymes: Eco RI…

A: (Note: According to given guidelines, we are supposed to answer only 3 subparts. Please repost other…

Q: Which forward are reverse primers will amplify the following sequence by PCR?…

A: As given in the question, forward and reverse primer sequences are to be identified to amplify the…

Q: Now that you’ve isolated the gene and made lots of copies, you need to insert the gene into…

A: Plasmids are used in genetic engineering to increase the number of copies of a gene. A plasmid is a…

Q: You want to clone a specific PCR amplicon. You have determined that the amplicon you want to clone…

A: Restriction enzymes are endonucleases derived from bacterial cells that cleave DNA (deoxyribonucleic…

Q: A researcher wants to cut this piece of linear DNA. 5 AGCTAGTCCGGATCCGAGGGCCCTTCTCATGAGATCCGGATGACC…

A: The discovery of restriction enzymes in 1968 by Swiss scientist "Werner Arber" ushered in the era of…

Q: You want to perform PCR on the CDNA of the spike gene from a SARS CoV-2 sample so that you can…

A: PCR stands for polymerase chain reaction. It is used to amplify the gene of internet because forward…

Q: A commonly used plasmid that we will use in this lab is PUC19: (New England Biolabs) Indl 91 BamBI…

A: pUC19 is a circular double stranded DNA having 2686 base pairs.It is one of the most widely used…

Q: Discuss the importance on the addition of ampicillin and arabinose to the medium of the genetically…

A: pGLO bacterial transformation experiment. Controls that were incubated with no plasmid (-pGLO) grow…

Q: Select two primers from the list below such that your selected primers create a pair capable of…

A: Primer is a short strand of nucleotide sequence which helps in synthesis of DNA. After the…

Q: 1. You have the plasmid pUC18/19, which is a circular plasmid that consists of 2686 bp. What would…

A: As per our guidelines, we are supposed to answer only one question. Kindly repost the other question…

Q: A researcher wants to cut this piece of linear DNA. 5'…

A: The restriction enzymes are the specific enzymes that act on the DNA molecule and perform its…

Q: Based on the restriction enzyme specificities given below, what was the enzyme utilized to produce…

A: The corner stone of genetic engineering or recombinant DNA technology is a special class of enzymes…

Q: be used for a restriction fragment length polymorphism (RFLP) diagnostic assay to identify…

A: Polymerase chain reaction, or  as we say PCR, is a technique used to make many copies of a specific…

Q: You are studying a new plasmid, and you digest the plasmid with three restriction enzymes: Eco RI…

A: The restriction digestion of plasmid DNA by using restriction nucleases is a useful tool in mapping…

Q: Sequencing reactions are done in separate tubes for each ddNTP with a radioactive primer. Which…

A: In our Desire primer it  is 15 nucleotide long however on gels there are only 10 bands are present…

Q: A. Use this data to generate a circular map of the plasmid. Pst I: 10 kb Bam HI: 10 kb Sal I:…

A: Restriction endonucleases are enzymes that cut DNA at specific sites. Restriction endonucleases…

Q: Which of the following would you need to clone a human gene? Choose all that apply A restriction…

A: Gene cloning is the interaction wherein a suitable gene is found and replicated (cloned) out of all…

Q: Write the process of, building a recombinant plasmid? Or how you can build a recombinant plasmid?

A: A plasmid is a circular, single-stranded DNA molecule that is distinct from a cell's chromosomal…

Q: You amplify the DNA sample shown with the indicated primers. Highlight in yellow the region that…

A:

Q: You cut a plasmid with a restriction enzyme that cuts it into three pieces-one fragment is 280 base…

A: Plasmids are circular double stranded DNA. These are basically found in the unicellular organisms.…

Q: All of the following are needed for PCR except: A) dNTP nucleotide monomers B) Oligonucleotide…

A: The polymerase chain reaction (PCR)  is a special process that is used for the amplification of…

Q: pls help very urgent, no explaantion required, pls help asap

A: In molecular biology, a restriction digest is a technique for preparing DNA for analysis or further…

Q: ________________ "cut" DNA at specific sequences and the resulting segment with sticky ends is…

A: Recombinant DNA Technology is a kind of technology that utilizes certain enzymes to cut the DNA into…

Q: -gene--- 5'-GTCGACAAGCTTAAGCCTAAGCTTTAGCGAAGCTTGTCGAC-3' Recognition sites Sall 5'-GTCGAC-3'…

A: Sticky ends are short single-stranded overhanging segments of one DNA strand after the Double DNA is…

Q: You are asked to design PCR primers (18 nucleotides) to amplify the coding region (without the stop…

A: If you cloned your DNA of interest between the BamHI and EcoRI sites, you could sequence using the…

Q: You are provided with coiled DNA and plasmid DNA that you subject to gel electrophoresis. Draw this…

A: Gel electrophoresis is the molecular biology technique used to separate the DNA fragments on the…

Q: The nucleotide sequence below is one half of a double stranded DNA sequence. The highlighted portion…

A: DNA molecule is the genetic material present in the animals. Genetic material  is present in the…

Q: You are studying a new plasmid, and you digest the plasmid with three restriction enzymes: Eco RI…

A: The plasmid map can be created by checking the individual band patterns and band patterns with a mix…

Q: Which of the sequences below would serve as a PCR primer that would bind this DNA strand: 5'-…

A: PCR is polymerase chain reaction. It is a method of DNA amplification developed by Kerry Mullis.…

Q: You are studying a new plasmid, and you digest the plasmid with three restriction enzymes: Eco RI…

A: Introduction: Gel electrophoresis: The technique of separating DNA fragments as per their size is…

Q: How many microliters of pGLO plasmid will you need for a PCR reaction is you need 200 nanograms and…

A: PCR (Polymerase Chain Reaction) is a series of three reactions that happen in order. It leads to the…

Q: Write down the primers spesific to Theileria annulata enolase. Calculate the Tm for each primer and…

A: Hi, Thanks For Your Question.  Answer : Because We Are Using pUC19 As A Vector, The Primers Should…

Q: The following sequences of DNA would be synthesized using 5′-CAGTTCGGA-3′ as a template: *…

A: DNA is synthesized in 5' to 3' direction.

Q: Recently, I am designing primers specific for Lactobacillus sp. (partial sequence of the 16s rRNA…

A: PCR or polymerase chain reaction is a technique used to amplify a given DNA fragment using specific…

Q: Entire sequence below needs to be amplified by PCR and subcloned into a plasmid vector. Which of the…

A: PCR, or the polymerase chain reaction, is a technique used by molecular biologists to amplify…

Q: For the following short sequence of double stranded DNA and the given primers, there will be one…

A: Polymerase chain reaction (PCR) is generally used to produce millions or even billions of copies in…

Q: The total size of the plasmid is 2686 bp. There is a PstI recognition site at position 439, HindIII…

A: Answer - d. 3 fragments: 447bp, 507bp and 1732bp

Q: Wells Base pairs: 6650 4973 4.3cm 3148 2396 1585 8 Ocm 692 > 10 Acm DNA size Markers Vector-EcoRI…

A: Hi, Thanks For Your Question.  Answer : First, Let Us See The Ladder Size. Let's Do Rounding Off…

Q: Image 1. Which 2 primers from the choices provided would work to amplify the DNA sequence given…

A: DNA strand for deoxyribose nucleic acid. It is the genetic material present in the cell.

Q: You have the plasmid pUC18/19, which is a circular plasmid that consists of 2686 bp. What would the…

A: A restriction endonuclease, also known as a restriction enzyme, is a bacterial enzyme that…

Q: What is a vector? Which vector did you choose? Explain why you made that choice. What enzyme(s) will…

A: Since you have asked a question with multiple subparts, we can only answer the first three subparts…

Q: You have set up a recombinant DNA experiment using the plasmid PBR322 as the vector (see plasmid…

A: PBR322 is a cloning vector which is widely used for cloning purposes. The map of PBR322 is given in…

Bacterial Genomics

The study of the morphological, physiological, and evolutionary aspects of the bacterial genome is referred to as bacterial genomics. This subdisciplinary field aids in understanding how genes are assembled into genomes. Further, bacterial or microbial genomics has helped researchers in understanding the pathogenicity of bacteria and other microbes.

Transformation Experiment in Bacteria

In the discovery of genetic material, the experiment conducted by Frederick Griffith on Streptococcus pneumonia proved to be a stepping stone.

Plasmids and Vectors

The DNA molecule that exists in a circular shape and is smaller in size which is capable of its replication is called Plasmids. In other words, it is called extra-chromosomal plasmid DNA. Vectors are the molecule which is capable of carrying genetic material which can be transferred into another cell and further carry out replication and expression. Plasmids can act as vectors.