You want to perform PCR on the CDNA of the spike gene from a SARS CoV-2 sample so that you can sequence it. Based on the sequence below, which of the following primer pairs would probably work for PCR of this gene? Spike gene Sequence: 5' ATGTTTATTTTCTTATTATTTTTTACTCTCACTAGTGGTAGTGACCTTGACCGGTGCACCACTTTTGATG ATGTTCAAGCTCCTAATTACACTCAACATACTTCATCTATGAGGGGGGTT TACTATCCTGATGAAATTTT . (it's really long so didn't post the whole thing..).TCTTGCTTTGTTGCATGACTAGTTGTTGCAGTTGCCTCAAGGGTGCATGCTCTTGTGGTTCTTGCTGCAA GTTTG ATGAGGATGACTCTGAGCCAGTTCTCAAGGGTGTCAAATTACATTACACATAA 3' Forward primer: 5' - CTC TCA CTA GTG GTA GTG ACC - 3' (Tm 60.5 °C in a standard qPCR mix) A. Reverse Primer: 5' GGG TGT CAA ATT ACA TTA CAC ATA - 3' (Tm= 59.6 °C in a standard qPCR mix) Forward Primer: 5'- ATG TTT ATT TTC TTA TTA TT -3' (Tm3D 47.2 °C in a standard qPCR mix) O B. Reverse Primer: 5'- GCA AGA ACC ACA AGA GCA TGC ACC -3' (Tm= 68 °C in a standard qPCR mix) Forward primer: 5' - CTC TCA CTA GTG GTA GTG ACC - 3' (Tm = 60.5 °C in a standard qPCR mix) Reverse primer: 5'- TAT GTG TAA TGT AAT TTG ACA CCC- 3' (Tm- 59.1 °C in a standard qPCR mix) Forward primer: 5' - CTC TCA CTA GTG GTA GTG ACC - 3' (Tm = 60.5 °C in a standard qPCR mix) OD. Reverse Primer: 5' - AAA TTA CAT TAC ACA TAA - 3' (Tm 46.8 °C in a standard qPCR mix)

You want to set up 50 µl total volume of a PCR reaction. You have a microfuge tube of Forward primer (25 µM), and each PCR reaction requires a final of 1 uM of primer. You have a microfuge tube of Reverse primer (25 µM), and each PCR reaction requires a final of 1 µM of primer. How much of the primers would you add? Select all that apply 2 ul of Reverse primer 2 ul of Forward primer 5 ul of Forward primer 5 ul of Reverse primer

After running a qPCR experiment, we will have graphs showing the amount of fluorescence detected by the digital camera compared to the number of PCR cycles run. Suppose you see the following graph output by the qPCR machine: Relative Fluoresence 3.0 2.5 2.0 1.5 1.0 0.5 0.0 0 10 20 30 40 50 Cycles Which curve (blue, red, or green) represents a sample with the smallest amount of mRNA present? Why? Be sure to discuss Ct values in your answer.

Select all that would be true if I had a nonsense mutation in an exon of a gene: The nonsense mutant allele would be the same size as wildtype by PCR-electrophoresis The nonsense mutant protein would be the same size by Western as the wildtype protein The nonsense mutant allele would be a different size compared to wildtype by PCR- electrophoresis The nonsense mutant protein would be a different size by Western compared to the wildtype protein

After you design the PCR primers, you run the PCR on fluid from the patient’s nasal swab. Next, you need to evaluate the results. PCR makes billions of copies of just one sequence in a sample. Since you know the sequence, you also know the length (number of nucleotides) of the region you copied. There are about 130 nucleotides in the N gene fragment. This is typically stated as 130 base pairs. How can you visualize DNA and estimate its size? Load the DNA sample into an agarose gel (similar in consistency to jello) and apply an electric current to the gel. The DNA is charged and will move through the gel. The longer the DNA fragment, the more slowly it moves. The DNA is visualized by adding a fluorescent dye to your sample that sticks to DNA. When you look at the gel under UV light, the DNA should glow. What is the charge of a DNA molecule? Based on #1, would you expect DNA to be drawn to the (+) or (-) electrode of the gel electrophoresis chamber?

The image below shows the general structure of a gene on a chromosome. The arrows above and below the chromosome indicate the binding positions of potential forward (F) and reverse (R) PCR primers. Select two primers from the list below that would exclusively amplify exon 3 in a PCR reaction. ut of Intron 1 Intron 2 +1 Poly-A signal ATG TAG F1 Exon 1 F4 Exon 2 F6 Exon 3 R6 R4 R3 R2 R1 Promoter Select all that apply: cross out Da. F1 cross out Ob. F2 cross out Oc. F3 cross out O d. F4 cross out O e. F5 cross out f. F6 cross out g. R1 cross out Oh. R2 cross out OL R3 cross out O. R4 cross out k. R5 cross out R6 TI

In PCR amplification Why is it important to know the length of the sequence you amplify?

Watch the following video called "Human Genome Project Video" (https://fod.infobase.com/OnDemandEmbed.aspx?lti=1&token=30037&wID=97629&loid=0&w=400&h=300) then answer the following question in one paragraph each with evidence from the film to support your answers.  5) Answer in one paragraph and using the video provided to answer the following: There are companies now allowing people to clone their deceased pets. How do you feel about this? What are some good points and bad points to this service provided by some companies in your mind? 6) Answer in one paragraph and using the video provided to answer the following: There is rumor that humans are being cloned in other areas of the world. What ethical considerations can you think of that could be a problem with this type of medical experimentation? What is your opinion?

If a researcher attempted to do a PCR amplification of the slc24a5 gene in the gol1 mutatant line, would their attempts have been successful? Why or why not? No; PCR amplification will not be successful because the gene is deleted in the golb1 mutatant line. No; PCR amplification will not be successful because there is a point mutation in the coding region of the gene. Yes; this mutant line had a point mutation that would not have impacted PCR. Yes; although the gene switch was mutated, it did not impact the promotor sequence. O O O O

The sequence of a template DNA is GGGCCATTCGAACGTCCGAAAATGCCCCTGAATGAAAATTTTGGCCC. The sequence of a primer used for PCR amplification of the above DNA is CCCGGTAAGCTT. Where is the 5' end for the template and primer, respectively?   answer options: 1) Left, left 2) Right, left 3) Left, right 4) Right, right 5) Right, left