The sequence of the DNA template strand is 3’–ATGGCAATAC–5’: What is the sequence of the DNA informational strand? What are the amino acids present in this sequence?
Q: What is the polypeptide that will be formed from the following DNA sequence? Template DNA…
A: In molecular biology complementary base pairing or complementarity is a reletion between the two…
Q: What is the mRNA coded by this template DNA strand? DNA Template Strand: 3' ATGGTACGGTCG 5'…
A: A codon is known to code by three different types of bases in a particular mRNA. Hence, a codon is…
Q: What enzyme adds on the new DNA strands? What is the monomer of DNA? What is Chargoff’s Rule? What…
A: DNA or deoxyribonucleic acid is the hereditary material found in almost all organisms. DNA is…
Q: If the sequence of bases in one strand of DNA is 5′ TAGCCT 3′,then the sequence of bases in the…
A: Answer is c.) 3'ATCGGA5'.
Q: If a segment of DNA is 5'CATTAC—3', the complementary DNA strand is (a)3'—CATTAC—5'(b) 3'—GTAATG—5'…
A: All living organisms store their genetic information in form of DNA / RNA. This genetic information…
Q: Which of the following sequences would be complementary to a DNA strand with the sequence…
A: Complementarity refers to a relationship between two structures each following lock and key…
Q: The following DNA sequence is at the start of a DNA strand: 3'—AATTCGAGATTCA—5'. Which of the primer…
A: The primer is the sequence of ribonucleotides which has free hydroxyl end for action of DNA…
Q: Which of the following represents a missense mutation in the DNA coding strand sequence, 5' -…
A: A change in the structure of DNA, known as a mutation, can alter the sequence of amino acids that…
Q: What will be the newly synthesized DNA from the template given? DNA Template 3 - CGGATGELLGTATAL -5…
A: DNA replication :- It is the formation of a new DNA from a pre existing DNA. The DNA so formed is…
Q: Write out the resulting DNA molecules after the following double stranded DNA molecule is digested…
A: DNA stands for deoxyribonucleic and. It is the genetic material present in the cell.
Q: Which of the following would be the correct complementary sequence to this strand of DNA: 5 ATTCGATC…
A: Question- Which of the following would be the correct complementary sequence to the strand of DNA…
Q: Create the complimentary strand for the DNA strand below. Make sure to label the parts and direction…
A: ••Complimentary strand of DNA is made by by process of Replication Replication is process in which…
Q: DNA in the cell, with a right handed helix and 10 base pairs (BP) per helical turn, is in the: Group…
A: The answer is BDNA WITH RIGHT HANDED HELIX AND 10 BASEPAIRS PER HELICAL TURN.
Q: If one strand of DNA is CGGTAC, the corresponding strand would be Group of answer choices GCCATG…
A: DNA or deoxyribonucleic acid is the genetic material in living organisms. In case of eukaryotic…
Q: When a DNA molecule unzips to form two strands, what is added to each strand? What is produced?
A: The process of copying the parent DNA helix into two identical daughter helices is called as DNA…
Q: 1. a) If one DNA segment has the following base composition, 5'-CAGTTAGTCA-3', which of the…
A: I Double stranded DNA the base pairing between the strands occurs as follows: A pairs with T and G…
Q: A portion of one strand of DNA has the sequence 5′ AATGGCTTA 3′. If this strand is used as a…
A:
Q: Given the following coding sequence for DNA, provide the sequence of the complementary(template)…
A: A nucleotide is a biomolecule that consists of a nitrogenous base (either a purine or a pyrimidine),…
Q: The template strand of a segment of double-helical DNA contains the sequence –…
A: Introduction: DNA is a type of nucleic acid present in the nucleus of the cell. It is the genetic…
Q: Whatis the purpose of the dideoxynucleotides in DNA sequencing? OCH2 base - OCH2 base H. H. H. H. H.…
A: ddNTP(dideoxynucleotide triphosphate) used in sanger dna sequencing .which terminate the…
Q: During DNA replication, the template sequence 5' ATAGGCC 3' would produce which one of the following…
A: Replication is a biochemical process by which the DNA is synthesized on itself. It is mode by which…
Q: Show the structure of a DNA where the lead strand is ATCG. Show H-, glycosidic, phosphoester…
A: DNA is Nucleic acid that consists of two strands that run in opposite directions. One of the stand…
Q: Which of the following would represent a section of DNA with a palindromic sequence? 5' TAT CCG 3'…
A: A palindromic sequence is a nucleic acid sequence in a double-stranded DNA or RNA molecule which on…
Q: Using the coding strand of a DNA molecule below, what will the first 6 bases of the template strand…
A: Coding strand - The strand of DNA whose base pairs sequence is identical to RNA transcript base pair…
Q: Which DNA strand is complementary to this template strand: 5’-GACGCT-3’? 5’-AGCGTC-3’ 3’-AGCTAG-5’…
A: All living organisms store their genetic information in form of DNA / RNA. This genetic information…
Q: What will be the newly synthesized DNA from the template given? DNA Template 3 - CGGATGCCCGTATAC -5…
A: DNA stands for deoxyribonucleic Acid. It is a long polymer of deoxyribonucleotides. It is found in…
Q: If the sequence of bases on the one of the strand of a DNA molecule 5’ATTGCGGA - 3’ What is the…
A: DNA is a double helical structure composed of nucleotides.The two helices are joined together by…
Q: Which of the following features of the DNA double helix are recognized by proteins that interact…
A: Option 1, 2 and 3 are the correct answer. Option 4 is incorrect.
Q: E.coli is replicating its chromosome. If the template DNA sequence is: 3' AAA CGC GAT 5', what would…
A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…
Q: Given the following template DNA strand, what is the correct complementary DNA sequence? 3' CGC AGT…
A: Nucleic acids are present inside the nucleus to store and pass genetic information and thus controls…
Q: One strand of a DNA molecule has the base sequence 5’-CACTTA-3’. The complementary base sequence on…
A: Deoxyribonucleic acid (DNA) is defined as an organic chemical molecule that will contain all the…
Q: BamHI recognizes 6 base pairs of DNA in a palindromic DNA sequence. If the first part of the…
A: Introduction BamH1 is a restriction enzyme that cleaves the DNA sequences at specific sites and it…
Q: What is the sequence of the newly synthesize DNA segment if the template strand has the following…
A: A DNA refers to a helical structure that is made of nucleotides. A nucleotide comprises a phosphate…
Q: 1) What is the size of the following single-stranded piece of DNA? ATCGTGTGCT A) 10 b B) 20 bp C) 20…
A: According to guidelines we have to answer the first question only. so please kindly post the…
Q: he sequence of the DNA template strand is 3’– GACTTCC – 5’ What is the sequence of the DNA…
A: DNA (Deoxyribonucleic Acid) It is defined as a genetic material which has all the stored genetic…
Q: Which of the following DNA sequence pairs are completely complementary? Group of answer choices…
A: Answer In DNA, Adenine (A) pairs with Thymine (T) and Guanine (G) pairs with Cytosine (C). Hence, on…
Q: Make the complementary strand for the following DNA template and label both strands as 5’ to 3’ or…
A: There is complementary pairing between the two strands of DNA that is adenine always pairs with…
Q: If the sequence of one strand of DNA is CTCGGA, the sequence of the complementary strand will be…
A: DNA has two strands that are antiparallel and complementary to each other. Antiparallel means that…
Q: Given a sequence of a DNA coding strand: 5’-ATGATTATCCTATAG-3’ What is the sequence and…
A: The complementary DNA sequence of DNA coding strand ATGATTATCCTATAG is TACTAATAGGATATC.
Q: What would be the complementary strand of DNA below? 3’-ACGTGCTACGGTACG-5’
A: DNA is usually double stranded. The two strands of a DNA are antiparallel to each other, that is, if…
Q: What does it mean for DNA to be antiparallel? -The two strands of polynucleotides are in opposite…
A: DNA is the hereditary material found in an organism.
Q: Make the complementary strand for the following DNA template and label both strands as 5’ to 3’ or…
A: Introduction: Adenine binds to thymine and guanine binds to cytosine as they are complementary base…
Q: Identify the type of mutation and how it would affect the protein made (amino acid) if the following…
A: The process of forming an mRNA sequence from the template DNA strand is known as Transcription. The…
Q: Based on one strand of a certain segment of DNA with the sequence below, answer the following…
A: DNA is the genetic material in all the living organisms.
Q: Given the following template DNA strand, what is the correct complementary DNA sequence? 3' CGC AGT…
A: DNA has a double helix structure composed of sugar, phosphate group, and four nitrogen bases.…
Q: What is the nucleotide sequence of the DNA strand that is complementary to 5'-GGCGCAACTGTCACAA-3'
A: A nucleic acid sequence is a set of five letters that indicates the order of nucleotides in a DNA or…
Q: Shown below is a DNA coding strand. A base (*G*) mutates to Adenine (A). What will be the resulting…
A: In this question, we are given a coding strand of DNA which has undergone mutation from *G* to A. A…
Q: If the template DNA sequence is 3' - CCC - ATA - GAG - AAA - 5' , then what is the corresponding…
A: DNA is molecule which is present inside a cell and contain the genetic information of an individual…
Q: If part of a gene had the base sequence TGC CAT, what would be the base sequence of the…
A: DNA (Deoxyribonucleic acid) is one of the nucleic acid elements which contains the genetic…
Q: What is one possible DNA strand that would produce the following amino acid sequence? (Do NOT…
A: A codon is a trinucleotide sequence of DNA or RNA that corresponds to a specific amino acid. The…
The sequence of the DNA template strand is 3’–ATGGCAATAC–5’:
- What is the sequence of the DNA informational strand?
- What are the amino acids present in this sequence?
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Give the complimentary DNA strand for the following:ACG TAG CTA GTC AGT CGT AGC Give the RNA strand for the following:ACG TAG CTA GTC AGT CGT AGC Using the provided amino acid table and the RNA strand you created in #2, create the amino acid sequence: Name and explain two different ways in which DNA can be damaged. Once DNA is damaged, can we repair it? If not, what are some possible outcomes from the damaged DNA?Given the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs ( what letter changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein. Wild Type DNA Sequence: 3' - AGGCTCGCCTGT - 5' Mutated DNA Sequence: 3' - AGTCTCGCCTGT - 5'If a given double stranded DNA undergoes enzymatic hydrolysis targeting only the "a" side in the phosphodiester bond, what are the consequent nucleotide products of the hydrolysis of the 2 strands? (Please write the answers using only the letters corresponding to the bases with either the p or OH beside it to indicate the phosphate and OH groups respectively.) Sequence in one strand: TCGATCAG
- If a given double stranded DNA undergoes enzymatic hydrolysis targeting only the "b" side in the phosphodiester bond, what are the consequent nucleotide products of the hydrolysis of the 2 strands? (Please write the answers using only the letters corresponding to the bases with either the p or OH beside it to indicate the phosphate and OH groups respectively.) Sequence in one strand: TCGATCAGWrite the sequence of the complementary DNA strand that pairs with each of the following DNA base sequences:(a) TTAGCC(b) AGACATFor the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: a) the sequence of the complementary DNA strand
- 11:29 Protein 6-10092015113530.pdf https:api.schoology.comv1attachment169963838... Name Class Date 2. How are enzymes involved in this process? 3. hаppens anzips"? 4. Why is it important that exact copies of DNA be made? 5. Suppose that a sequence of one DNA strand is T-A-C-A-A-C-G-T-G. What is the corresponding sequence on the other strand? E Concept Mapping The construction of and theory behind concept mapping are discussed on pages vil-ix in the front of this Study Guide. Read those pages carefully. Then consider the concepts presented in Section 7-1 and how you would organize them into a concept i page 74. Notice that the concept map has been started for you. Add the key Now look at the concept map for Chapter 7 on concepts you are important Secti When you have finished the chapter, you will have a completed concept map. 69 1 of 1Given the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs (what letters changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions (with spaces), and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein. Wild Type DNA Sequence: 3' - CCTCGTTATGTG - 5' Mutated DNA Sequence: 3' - CCTCGTTATTTG - 5'Here is a DNA coding strand’s sequence and direction: 5’-ATGCCGATATAG-3’ . What would be the amino acid sequence in the polypeptide encoded by this DNA?
- If a given double stranded DNA undergoes enzymatic hydrolysis targeting only the "a" side in the phosphodiester bond, what are the consequent nucleotide products of the hydrolysis of the 2 strands? (Please write the answers using only the letters corresponding to the bases with either the p or OH beside it to indicate the phosphate and OH groups respectively.) Sequence in one strand: TCGATCAG Use the editor to format your answerEukaryotic Genetic Sequence: 5'-TAC CAT GAT CCC TAT - 3' 1. What would be the newly synthesized DNA strand and explain how the strand will be replicated. Where in the cell would this occur? 2. What would be the synthesized mRNA strand, and how is it transcribed from the original DNA strand, and then converted from a pre-mRNA strand to a mature mRNA? Where in the cell does this occur? 3. What would be the anti-codons for the tRNA. What are the amino acids generated based on the RNA. How are these amino acids translated into protein and where in the cell does this happen?The DNA STRAND IS 3’ TAC-AGC-ACT-CAG-TCA 5’, and Non-template strand = 5' - ATGTCGTGAGTCAGT - 3' . If on the non-coding strand of DNA there is suddenly one T base that sneaks into the 4th sequence (from the left), or causes a mutation, then how will the RNA be formed and the chain arrangement of the amino acids produced by this mutation?