11:29Protein 6-10092015113530.pdfhttps:api.schoology.comv1attachment169963838...NameClassDate2. How are enzymes involved in this process?3.hаppensanzips"?4. Why is it important that exact copies of DNA be made?5. Suppose that a sequence of one DNA strand is T-A-C-A-A-C-G-T-G. What is thecorresponding sequence on the other strand?E Concept MappingThe construction of and theory behind concept mapping are discussed onpages vil-ix in the front of this Study Guide. Read those pages carefully. Thenconsider the concepts presented in Section 7-1 and how you would organizethem into a concept ipage 74. Notice that the concept map has been started for you. Add the keyNow look at the concept map for Chapter 7 onconcepts youare importantSectiWhen you havefinished the chapter, you will have a completed concept map.691 of 1

Name: 11:29Protein 6-10092015113530.pdfhttps:api.schoology.comv1attachment1
Uploaded: 2022-09-26T13:05:49.000Z
Channel: Bartleby
Description: 11:29Protein 6-10092015113530.pdfhttps:api.schoology.comv1attachment169963838...NameClassDate2. How are enzymes involved in this process?3.hаppensanzips"?4. Why is it important that exact copies of DNA be made?5. Suppose that a sequence of one DNA s

This page contain link but that link is not opening so we are answering first 3 questions. For rest…

Answered: 2. How are enzymes involved in this…

Science

Biology

2. How are enzymes involved in this process? 3. What happens when DNA "unzips"? 4. Why is it important that exact copies of DNA be made?

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter17: Metabolism: An Overview

Section: Chapter Questions

Problem 13P: What Art the Features of the Series of -omes? Define the following terms: a. Genome b. Transcriptome...

See similar textbooks

Similar questions

10:14 Protein 5-10092015113503.pdf https:api.schoology.comv1attachment169963838... Name Class Date RNA (pages 146-148) | SECTION REVIEW In this section you were introduced to the molecule that helps put the information in DNA to use: ribonucleic acid, or RNA. ANA Iis a nucleic acid that carries information from DNA to the ribosomes, the organelles in which proteins are made. RNA also carries out the process by which proteins are assem- bled from amino acids. RNA is quite similar to DNA in structure. However, there are some important differ- ences. RNA is single-stranded; DNA is dou- ble-stranded. RNA contains the sugar ribose; DNA contains deoxyribose. And RNA has the nitrogenous base uracil; DNA has thymine. In this section you also learned about the process of transcription. Transcription is t process in which part of a DNA molecule is used as a template for the synthesis of a com- plementary strand of RNA. This process is mediated by an enzyme called RNA poly- merase. The strand of…
There are 6 parts to this question: This is a follow up to the prior question regarding the replication of the DNA strand below. The DNA strand is here for your reference and you do not need to do anything with or to it. TC GATATCGG AGCTATAGCC c) what enzyme separated the parental DNA template strands, d) what bonds were broken? e) what enzyme replicates DNA f) before DNA can be replicated/copied, what must be laid down to allow the enzyme in "e" to replicated the DNA (be specific)? g) our DNA is replicated in many "pieces", what enzyme connects these many "pieces" into one continuous DNA strand that becomes the sister chromatid? h) during what specific phase of the cell cycle does this DNA replication process occur? (This should be a review question from last topics we covered).
8:52 Protein 1-10092015113603.pdf https:api.schoology.comv1attachment169963839... Name Class Date Section Protein Synthesis pages 148-153) 7-3 SECTION REVIEW In this section you studied the process of pro- tein synthesis. You learned that the informa- tion that DNA transfers to messenger RNA (MRNA) is in the form of a code. When the information is decoded, chains of amino acids, called polypeptides, are formed. Polypeptides During translation, each MRNA codon in turn make up proteins, which direct biochemical pathways and are responsible for cell structure and movement. The genetic code is determined by the arrangement of the nitrogenous bases in DNA and RNA. A code word in DNA consists of a group of three nucleotides. When transcribed into MRNA, each code word, or codon, desig- nates a specific amino acid that is to be placed in the polypeptide chain. More than one codon may code for a particular amíno acid. The MANA sequence AUG serves as an initiator, or "start," codon. Three other…
The beginning of the hexose kinase gene's sequence can be found below, the +1 nucleotide is underlined and bolded. It also contains an origin of replication (ORI) which is found at position 30. 1 20 ORI 40 60 5...ТTCGAGCтСТСGТСGTCGAGATACGCGATтGATATTACTGGTAATАTGGGGATGCACTATC...3' 3'..AAGCTCGAGAGCAGCAGCTCТАTGCGOТАСТАТААТGACCATTATACСССТАСGTGATA...5" promoter 2a. Assume that replication has been initiated at that ORI. Provide the sequence of the primer that is complementary to the DNA in each of the following positions. Site A - binding to the top strand of the DNA at position 20 – 30 5' 3' Site B - binding to the top strand of the DNA at position 31 – 41 5' 3' 2b. Replication is occurring normally in these cells; would you expect to find a primer in both positions? Why or why not?
Which of the following sequences on a DNA molecule would be complementary to GCTTATAT? TAGGCGCG ATCCGCGC CGAATATA TGCCTCTC
What Art the Features of the Series of -omes? Define the following terms: a. Genome b. Transcriptome c. Proteome d. Metabolome e. Fluxome
Given the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs ( what letter changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein. Wild Type DNA Sequence: 3' - AGGCTCGCCTGT - 5' Mutated DNA Sequence: 3' - AGTCTCGCCTGT - 5'
EcoRI recognizes G A-A-T-T-C sequence and cleave/ cut between G and A. How will the DNA fragments look like if EcoRI is used for the DNA below? How many fragments are produced? 5- AAAGATTTGAATTTCGAATTCAATTTAAGAATTCCCTTAGAATTTCC -¹3
Eukaryotic Genetic Sequence: 5'-TAC CAT GAT CCC TAT - 3' 1. What would be the newly synthesized DNA strand and explain how the strand will be replicated. Where in the cell would this occur? 2. What would be the synthesized mRNA strand, and how is it transcribed from the original DNA strand, and then converted from a pre-mRNA strand to a mature mRNA? Where in the cell does this occur? 3. What would be the anti-codons for the tRNA. What are the amino acids generated based on the RNA. How are these amino acids translated into protein and where in the cell does this happen?
There are 2 parts to this question: The following DNA strand (below) is about to undergo DNA replication. a) Please replicate the parental strands into two exact copies TC GATATCGG AGCTATAGCC b) place a centromere between the two replicated copies (or tell me where the centromere would be located),
a) Under normal conditions E. coli produces three DNA polymerases. State their functional similarities and differences. b) List the other proteins and enzymes involved in DNA replication in E.coli and give their functions.
This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' (i) Draw the structure of hairpin loop that will be formed during the end of transcription. (ii) Describe the function of the hairpin loop during transcription.