Which of the following DNA sequence pairs are completely complementary? Group of answer choices 5’-AGTCTTAGC and 5’-GCTAAGACT 5’-CTGACCTGG and 5’-GGTCCAGTC 5’-TTGATGACC and 5’-TTGATGACC 5’-GAGCTAATA and 5’-GAGCATTAT

Give typing answer with explanation and conclusion

Using the correct base pairing rules for DNA replication, what would be the complementary strand for the strand TACCGATGC? Multiple Choice   TACCGATGC   ATGGCTACG   None of the answer choices are correct.   GCTAGTCGA   TTCCGTTCG

Below are some nucleotide sequences located on a segment of one strand of DNA, from the 5'to the 3' Indicate the complementary sequence of nucleotides that would appear on the adjacent DNA strand from the 3' to the 5' end. 5' AGTCCG 3'           5' CCTTGA 3'

DNA A= 5' GGG GCT AGC CCC 3' DNA B= 3' ATA TAT ATA CCC 5' DNA C= 5' TAC GTT ACG TCG 3' DNA D= 3' ATC TTT GCA TTA 5' The DNA strand that is capable of forming a hairpin loop

What is the DNA complement to this DNA sequence: TGAGCCTTAGGA? O UCTCGGUUTCCT O ACTCGGAATCCT O ACUCGGAAUCCU

The phenomenon where double-helical DNA absorbs UV light less than does single-stranded DNA is referred to as intercalation hyperchromism hypochromism base-stacking None of the these are correct.

Write down the complement strand of DNA for the following sequence and place the 3' and 5' on the appropriate ends.   3' - GGGCCTAATATAGCTTTACGGTAT - 5'

The X's correspond to the missing information. You need to determine what those X's represent DNA STRAND: XXX-CCC-GGG-GCG-XXX-XXX-XXX-GCC-ATA-TTA-XXX RNA STRAND: XXX-XXX-XXX-XXX-XXX-XXX-XXX-XXX-XXX-XXX-XXX PROTEIN: Met - X - X-X - Thr - Val - Glu-X-X-X - Trp To be clear, your answer is just the 3 sequences above without the X's (the highlighted yellow parts). There may be more than 1 correct answer for some parts of this assignment. Any answer your choose is fine. If you are unclear on how there could be more than 1 correct answer, review the lecture related to protein translation. Provide me with the: 1. Complete DNA sequence of 33 nucleotides 2. Complete RNA sequence of 33 nucleotides 3. 11 amino acids