Which of the following DNA sequence pairs are completely complementary? Group of answer choices 5’-AGTCTTAGC and 5’-GCTAAGACT 5’-CTGACCTGG and 5’-GGTCCAGTC 5’-TTGATGACC and 5’-TTGATGACC 5’-GAGCTAATA and 5’-GAGCATTAT

Which of the following DNA sequence pairs are completely complementary? Group of answer choices 5’-AGTCTTAGC and 5’-GCTAAGACT 5’-CTGACCTGG and 5’-GGTCCAGTC 5’-TTGATGACC and 5’-TTGATGACC 5’-GAGCTAATA and 5’-GAGCATTAT

Anatomy & Physiology

1st Edition

ISBN:9781938168130

Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble

Publisher:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble

Chapter3: The Cellular Level Of Organization

Section: Chapter Questions

Problem 17RQ: Which of the following sequences on a DNA molecule would be complementary to GCTTATAT? TAGGCGCG...

See similar textbooks

Related questions

Q: Meiosis: Events Put the letter of each meiotic stage next to the correct event. Use each answer choi...

A: meiosis is a type of cell division in which the daughter cells have half the number of chromosomes ...

Q: Number orchromosomes In HumanCell atDITerence Stages or MelosIs Identify the number of chromosomes i...

A: 1. 46 2.46 3. 46 4. 23

Q: Which of these pairs of scientist and their discovery is mismatched? Group of answer choices Jean Ba...

A: The given question is related with the discovery of the scientist.

Q: While working in your laboratory, you isolate an mRNAfrom C. elegans that you suspect is essential f...

A: In a variety of species, double-stranded RNA-mediated interference (RNAi) is a straightforward and q...

Q: Explain how the cell uses glycogen as an energy source. Connect the use of glycogen for energy to th...

A: Glycogen is a large, branched polysaccharide that is the main storage form of glucose in animals and...

Q: Font Styles White-eyed fly x Red-eyed fly Number of Offspring Phenotype of Offspring red eyes (norma...

A: As per our company guideline we are supposed to answer only first question or first 3 sub parts of t...

Q: Compare and contrast Gene Regulation in prokaryotes and eukaryotes

A: ANSWER;- - The main difference between prokaryotic and eukaryotic gene articulation is that the who...

Q: 34- Which of the following sentences is incorrect: a- Muscle fibers and neurons are similar because ...

A: there needs a correction in question part. it is saltatory conduction.

Q: 3- a muscle contracts more forcefully if: a- its motor units contracted simultaneously. b- the amoun...

A: Muscle contraction is regulated through the the function of alpha motor neuron/lower motor neurone w...

Q: What are the similarities and/or differences between interpreting Multiple Sequence Alignment (MSA) ...

A: Multiple sequence alignment (MSA) is the process or outcome of aligning three or more biological seq...

Q: Noncompetitive inhibition can often be explained by which of the following models? the induced fit m...

A: The action of enzyme depends on different factors. Enzymes are biocatalysts in nature. All the react...

Q: Research suggests that there are several SAR-CoV-2 variants circulating in the Jamaican population. ...

A: SARS-CoV-2 The SARS-CoV-2 virus is responsible for causing Coronavirus Illness (COVID-19), an infec...

Q: What are the adaptations of parasitic nematodes that make them successful as endoparasites? Please i...

A: Nematodes include round worms These are free living or parasitic .Body wall is made of thick cuticl...

Q: processes involved in

Q: 6. A portable E-cylinder of oxygen has 1760 psig. In approximately what time frame will the cylinder...

A: There are different forms of oxygen cylinder that can be found in the market. Some of the forms incl...

Q: based on the attached photo, compute the cfu/ml of 42 colonies at plate 10^5. show the complete solu...

A: To calculate the colony-forming unit per ml (cfu/ml) following formula can be used. CFU/ml= no. of c...

Q: 4) Bacteria- and cells in general- are enclosed in a semipermeable membrane. Use this information to...

A: Adding sugar or salt is an age old technique for preservation of food for long terms

Q: vetebrae

A: The vertebrae regions shown here are the cervical , thoracic and the lunbar vertebrae .

Q: I missed a couple of my labs due to covid and am struggling to teach myself how to do serial dilutio...

A: The last two years have been extremely difficult because you can still learn and understand the theo...

Q: Which of the following would be least likely to cause the sympathetic nervous system to activate? Lo...

A: sympathetic nervous system does accelerate heart rate, decrease motility, widen bronchial passages, ...

Q: How do enzymes work? What is catalase? Explain how the catalase activity is measured.

A: Enzymes are proteins that speed up our bodies' metabolism, or chemical reactions. They build some th...

Q: How is genetic engineering used to create bacteria capable of producing human insulin?

A: Introduction When bacteria produce human insulin, the human insulin gene is incorporated into the ge...

Q: Why are recombinant DNA technology and nucleus transplantation technology still dangerous?

A: Recombinant DNA (rDNA) is a technique for cutting and pasting DNA sequences of interest using enzyme...

Q: A person traveled to Asia and is having trouble with jet lag. What would be the best way to get used...

A: Answer Jet lag, also known as jet lag disorder, is a transitory sleep issue that can affect anybody ...

Q: Velocity of action potential is slower in myelinated than in unmyelinated.

A: A. Velocity of the action potential is slower in myelinated sheath than in ummyelinated.

Q: The action potential is fired by: - Opening K+ channels by subthreshold response p- Opening Na Chann...

A: Action potential can be outlined as the phenomenon in which there occurs rapid increase in the membr...

Q: Meiosis: Events Put the letter of each meiotic stage next to the correct event. Use each answer choi...

A: Meiosis is a sort of cell division that redices the quantity of chromosomes in the parent cell by ha...

Q: 41. The template strand of a gene has the sequence 3'-TCCCATGAG-5', Which of the following would be ...

A: Amino acids are the structural unit of proteins. there are majorly of 20 amino acids which are divid...

Q: Question 5 (1) Phosphate + ribose is a nucleotide (2) Tertiary structure in DNA is also known as dou...

A: Structure of DNA , nucleotides, nucleosides. DNA is a polymer of nucleotides called as a polynucleot...

Q: 7. Hereditary ichthyosis in humans is a sex-linked trait. If a normal male and a carrier female prod...

A: Inheritance pattern is a phenomenon which determines how traits are transferred from parental genera...

Q: Compare and contrast TRANSLATION in prokaryotes and eukaryotes

Q: High-energy electrons being passed from carrier to carrier along the electron transport system in ce...

A: This question belongs to the function of electron transport chain.

Q: Huntington’s disease is an autosomal dominant disease in humans, but the first symptoms usually don’...

A: Autosomal dominant disorder inheritance The dominant autosomal mutated gene cause the defect in gene...

Q: Which of the following is inversely related to the rate of diffusion for certain substance: a- Diffu...

A: Diffusion can be defined as a process in which there is movement of moleules takes place from the re...

Q: What is lymph

A: Lymphatic system includes lymph, lymph nodes, lymph organs (such as tonsils, thymus, spleen) as well...

Q: Which of the following is TRUE in regard to water vapor as a greenhouse gas? Select all that apply. ...

A: Option 1 And 2 is false . Option 3 and 4 is true.

Q: Protons move across the thylakoid membrane in both directions during the light reactions of photosyn...

A: Photosynthesis is the process that involves generation of simple carbohydrates (glucose) by using so...

Q: Which level of classification is the LEAST inclusive? Group of answer choices phylum kingdom family ...

A: The system of classification classifies organisms into different levels of taxonomic groups. Inclusi...

Q: is the protein produced by S. aureus that causes od to release attractants. PLV kills which release ...

A: surface proteins that are covalently attached to peptidoglycan, which are known as cell wall-anchore...

Q: 1.What is the Purpose of SEPT ? 2.What is Sports Endurance Plank Test (SEPT)? 3. What are the Benefi...

A: Part 1. SEPT can be expanded as Sports Endurance Plank Test. The aim or the main purpose of this tes...

Q: Which of the following is NOT part of the endomembrane system? O chloroplast O plasma membrane Ovesi...

A: Introduction: A cell is the smallest unit of life which has a definite structure and a specific func...

Q: Keep answers, short, simple, and concise. No detail required. Is ATP produced during the light ...

A: The photosynthesis is the process that involves production of carbohydrates (glucose) by using energ...

Q: 1. If you have the dominant trait and one of your parents shows the recessive trait, what is your ge...

A: The phenotype of an individual is governed by the genotype. A genotype is a set of genes present in ...

Q: Based on this report (and assuming that none of the compounds significantly increased inflammation),...

A: The scientists have isolated there compounds and are checking out its efficacy in mice. The muscle d...

Q: 31- which of the following is not always a component of a reflex arc: a- effector organ C- CNS b- af...

A: Reflex action is involuntary movement in response to stimulus. Reflex arc is a neural pathway.

Q: One molecule of NADH results in the production of 3 ATP molecules because: a. NADH contains 3 hydro...

A: NADH It stands for nicotinamide adenine dinucleotide + hydrogen. It's an important part of the red...

Q: In your own words: •Explain the process of Mitosis •Explain the Process of Meiosis

A: Mitosis is the equational division. Meiosis is the reductional division.

Q: D Test =4.23; HSD[.01]=5.36 nonsignificant M1 = mean of Sample 1 M2 = mean of Sample 2 and so forth....

A: Since the researchers need to compare that how has the drug affected the population and do the compa...

Q: Beta turn (B-turn) Type I and l'are shown below. The type of turn shown in the beta-hairpin structur...

A: * The beta hairpin also called as beta ribbon or beta beta unit. * Beta unit is a simple protein mot...

Q: Meiosis: Sequence of Stages Number the stages of meiosis from 1 to 8 to show their correct chronolog...

A: Meiosis is a reductional division contains meiosis-I and II. In meiosis-I, the prophase-I is the lon...

Question

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Find the complement DNA sequences to the following DNA sequences:Sequence # 1: GATATAGTSequence # 2: GAGGTTCSequence # 3: AACTAGATSequence # 4: CCTATAAGSequence # 5: AACGTGAT
Which of the following DNA sequence pairs are completely complementary? O 5'-AGTCTTAGC and S'-GCTAAGACT O 5-CTGACCTGG and 5-GGTCCAGTC O 5-TTGATGACC and 5' TTGATGAC O 5-GAGCTAATA and 5'-GAGCATTAT
the following segment of DNA codes a protien. 5' - TGATGATATTCCAgaargGATG AGCaataGCACATTGATA-3
#1 HindII --- 5’ GTC ↓ GAC 3’ 5’ ACGACGTAGTCGACTTATTAT GTCGACCCGCCGCGTGTCGACCATCA 3’ 3’ TGCTGCATCAGCTGAATAATACAGCTGGGCGGCGCACAGCTGGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
If one DNA segment has the following base composition, 5'-CAGTTAGC-3', which of the following sequences is complementary? 5'-GCTAACTG-3' 5'-GTCAATCG-3' 5'-GCTAAGCT-3' 3'-GCTAACTG-5'
5. The nucleotide sequences of the DNA molecules in the figure below were obtained from four different individuals, one wild type and three mutants. Wild Type 5'-TTATCCATGATCGGATCGATCCATTAGCCGA-3' 3'-AATAGGTACTAGCCTAGCTAGGTAATCGGCT-5’ Mutant I 5'-ATCCATGATCGGATTGATCCATTAGCCGAAT-3’ 3'-TAGGTACTAGCCTAACTAGGTAATCGGCTTA-5’ Mutant II 5'-CCGTTATCCATGATCGGATAGATCCATTAGCC-3’ 3'-GGCAATAGGTACTAGCCTATCTAGGTAATCGG-5’ Mutant III 5'-CACCGTTATCCATGATCGGAACGATCCATTAGC-3’ 3'-CAGGCAATAGGTACTAGCCTTGCTAGGTAATCG-5’ a) Identify the open reading frames in each sequence of DNA and translate them into proteins. Write down the sequence of amino acids that will be obtained after translation: b) Which of the mutations above would be least likely to cause a change in the function of the protein? Why? c) Which of the mutations above would probably cause a major disruption in the function of the protein? Why?
#3 HaelII --- 5’ CC ↓ GG 3’ 5’ ACGCCGGCCGTATTAT CCGGATCCGCCG CCGGCTGTCCCGGATCA 3’ 3’ TGCGGCCGGCATAATAGGCCTAGGCGGCGGCCGACAGGGCCTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
What is the DNA complement to this DNA sequence: TGAGCCTTAGGA? O UCTCGGUUTCCT O ACTCGGAATCCT O ACUCGGAAUCCU
Which of the following sequences on a DNA molecule would be complementary to GCTTATAT? TAGGCGCG ATCCGCGC CGAATATA TGCCTCTC
Which of (a)-(d) is complementary to the DNA segment 5'-ATGAGCCAT-3'? * 5-ТАСТССGTА-3' 5-ТАСТСGGTА-3' 5'-TCATCGGTA-3' 5'-TACTGCGTA-3'
#2 EcoRI --- 5’ G ↓AATTC 3’ 5’ ACG ACGTATTAGAATTCTTA TCCGCCGCCGGAATTCT CATCA 3’ 3’ TGC TGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
#4 BamI --- 5’ CCTAG ↓G 3’ 5’ ACGCCTAGGACGTATTATCCTAGGTAT CCGCCGCCGT CATCA 3’ 3’ TGCGGATCCTGCATAATAGGATCCATAGGCGGCGGCAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut: