Given a sequence of a DNA coding strand:     5’-ATGATTATCCTATAG-3’ What is the sequence and direction of the complementary DNA strand?

What is the sequence of a newly synthesized DNA segment if the template strand has each of the following sequences? Part 1 of 4 3'-ACTACAGG-5' 5'- -☐ -3' Part 2 of 4 5'-GTGTTAT-3' 3'- -☐ -5' Part 3 of 4 ☑ 3'-TCAACCATA-5' 5'- ☐ -3' Part 4 of 4 5'-AAATTA CAAC-3' 3'- -5' Х

Protein synthesis is a complicated process involving DNA being transcribed to RNA, which is then translated into amino acids. Complete the DNA-to-amino acid table for three consecutive codons with the appropriate nucleotides and amino acids using a codon table. Nucleotide and amino acid options can be used multiple times or not at all. 5' to 3' DNA strand T T A G A G 3' to 5' DNA strand A A T C T C G C G transcribed mRNA U U A G A G C G C TRNA anticodon A. A U C U G C G amino acid leucine glutamic acid Answer Bank A glutamic acid leucine cysteine arginine proline U

Give the mRNA and amino acid sequence from this DNA strand: TACATACCTCGGCTTTGGCTGAAAGGTACTTATAATGCT

5’ GGACCTATCAAAATCCTTAATGCGCTAGGATAGCTAACGCATCCAC3’ Fill in the complimentary DNA strand and label the polarity (the 5’ and 3’ ends)

36/ 50 In the fece representing DNA replication, which letter represents the leading strand? AA C.C DD E None of the above

What is the conformation of the glycosidic bond (i.e. orientation of the nucleobase relative to the the sugar) in the B-form of DNA?     syn     anti     alpha     hetero

One strand of a DNA helix has the sequence: 5'-ATTGCCGTC-3' Write the sequence of its complementary strand in the conventional 5' - 3' direction

If the mRNA sequence is  5'-UUU-CCC-AAA-3'.The DNA coding strand should be 5'-TTT-CCC-AAA-3' ?The DNA template strand should be 3'-AAA-GGG-TTT-5' ?So in the 5 to 3 direction, the DNA template strand should be  5'TTT-GGG-AAA-3' ?

If one DNA segment has the following base composition, 5'-CAGTTAGC-3', which of the following sequences is complementary?   5'-GCTAACTG-3'   5'-GTCAATCG-3'   5'-GCTAAGCT-3'   3'-GCTAACTG-5'