The replication bubble shown has a number of RNA primers (blue) bound to the two strands of the unwound double helix. In some areas of the replication bubble, new DNA (red) has begun to be synthesized. 3' A Replication fork movement D Origin of replication (on) B C Replication fork movement Which of the following statements is correct? 1.DNA polymerase III will continue extending the DNA at the location indicated by arrow B. 2.At some point during the replication process, the enzyme ligase will be needed at the location indicated by arrow D. 3.At some point during the replication process, DNA polymerase I will add bases at the location indicated by arrow C. 4.Arrows A and D are both pointing to a 3' end of RNA.

The replication bubble shown has a number of RNA primers (blue) bound to the two strands of the unwound double helix. In some areas of the replication bubble, new DNA (red) has begun to be synthesized. 3' A Replication fork movement D Origin of replication (on) B C Replication fork movement Which of the following statements is correct? 1.DNA polymerase III will continue extending the DNA at the location indicated by arrow B. 2.At some point during the replication process, the enzyme ligase will be needed at the location indicated by arrow D. 3.At some point during the replication process, DNA polymerase I will add bases at the location indicated by arrow C. 4.Arrows A and D are both pointing to a 3' end of RNA.

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter28: Dna Metabolism: Replication, Recombination, And Repair

Section: Chapter Questions

Problem 8P: Human Genome Replication Rate Assume DNA replication proceeds at a rate of 100 base pairs per second...

See similar textbooks

Similar questions

Multiple Replication Forks in E. coli II On the basis of Figure 28.2, draw a simple diagram illustrating replication of the circular E. coli chromosome (a) at an early stage, (b) when one-third completed, (c) when two-thirds completed, and (d) when almost finished, assuming the initiation of replication at oriC has occurred only once. Then, draw a diagram showing the E. coli chromosome in problem 3 where the E. coli cell is dividing every 20 minutes.
Semiconservative or Conservative DNA Replication If 15N-Iabeled E. coli DNA has a density of 1.724 g/mL, 14N-labeled DNA has a density of 1.710 g/mL, and E. coli cells grown for many generations on 14NH4+as a nitrogen source are transferred to media containing 15NH4+as the sole N-source, (a) What will be the density of the DNA after one generation, assuming replication is semiconservative? (b) Suppose replication took place by a conservative mechanism in which the parental strands remained together and the two progeny strands were paired. Design an experiment that could distinguish between semiconservative and conservative modes of replication.
Human Genome Replication Rate Assume DNA replication proceeds at a rate of 100 base pairs per second in human cells and origins of replication occur every 300 kbp. Assume also that human DNA polymerases are highly processive and only two molecules of DNA polymerase arc needed per replication fork. How long would it take to replicate the entire diploid human genome? How many molecules of DNA polymerase does each cell need to carry out this task?
Replication of a circular DNA molecule can occur by either theta () replication or by rolling circle replication. Describe or explain three differences between these two modes of DNA replication (you must accurately describe differences between the two approaches to replication - an accurate statement about one form of replication that does not clearly indicate how the other form differs is not a correct)
he bases of one of the strands of DNA in a regionwhere DNA replication begins are shown at the endof this problem. What is the sequence of the primerthat is synthesized complementary to the bases inbold? (Indicate the 5′ and 3′ ends of the sequence.)5′ AGGCCTCGAATTCGTATAGCTTTCAGAAA 3′
Assume that the sequence of bases shown below is presenton onenucleotide chain of a DNA duplex and that the chain has openedup at a replication fork. Synthesis of an RNA primer occurs on thistemplate starting at the base that is underlined.(a) If the RNA primer consists of eight nucleotides, what is itsbase sequence?(b) In the intact RNA primer, which nucleotide has a free 3'-OHterminus?3'.......GGCTACCTGGATTCA....5'
During DNA replication, one of the new strands of DNA is synthesized continuously, while the other is synthesized as a number of separate fragments of DNA that are subsequently linked by DNA ligase. This is because O replication starts at many points on the chromosome RNA primers only anneal to one of the parental strands of DNA one of the parental strands is unwound slower than the other by helicase DNA polymerase III only synthesizes DNA in the 5' - 3' direction
Polymerases usually add only about 10 nucleotides toa DNA strand before dissociating. However, during replication, DNA pol III can add tens of thousands ofnucleotides at a moving fork. How is this additionaccomplished?
Slide 11 Please help me explain this on my report on cell dogma
Would my anwser be correct for this question?
All known DNA polymerases catalyze synthesis only in the 5' → 3' direction. Nevertheless, during semiconservative DNA replication in the cell, they are able to catalyze the synthesis of both daughter chains, which would appear to require synthesis in the 3' → 5' direction on one strand. Explain the process that occurs in the cell that allows for synthesis of both daughter chains by DNA polymerase
Shown below is a long template strand of DNA where lagging strand DNA synthesis is occurring. The short horizontal lines represent two Okazaki fragments that have already been made. In the context of the replication fork, select the letter(d–g) that indicates where primase will synthesize the next RNA primer. Explain why did you choose that location?