Answered: (a) What is the function of helicase in…

(a) What is the function of helicase in DNA replication? (b) What is the function of DNA polymerase? (c) What are replication forks? Compare and contrast leading and lagging strands.

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Related questions

Q: rovide a detailed description and hand-drawn figure for each of the following. (1) DNA…

A: DNA REPLICATION:- It is the process of making two identical daughter copies of DNA from the one…

Q: DNA polymerases have a shape resembling a right hand with three functional domains. What are the…

A: The enzyme DNA polymerase is in charge of DNA replication. This enzyme's purpose is to split a…

Q: In which direction does replication go?

A: DNA replication is a semi-conservative type of replication where the two strands of DNA act as a…

Q: During DNA replication, as DNA unwinds it can become supercoiled causing twists that stress the…

A: DNA (deoxyribonucleic acid) is a double-stranded molecule in which the two strands wind around each…

Q: The base sequence on one strand of DNA is ATGTCTATA(i) Give the base sequence of its complementary…

A: The deoxyribonucleic acid is the genetic material that is passed from one generation to another…

Q: In DNA replication, what is the primer composed of and whyare there leading and lagging strands?

A: DNA replication is a biological process that results in formation of exact copies of DNA which is…

Q: Distinguish between (a) unidirectional and bidirectional synthesis, and (b) continuous and…

A: Answer- DNA replication or synthesis of DNA is the formation of DNA from the parental strand in the…

Q: Separates DNA strands to expand the replication bubble. , DNA polymerase . Uses template strand to…

A: i)- Separates DNA strands to expand the replication bubble-Helicase ii)-Uses template strand to…

Q: AKS 5b: Using the semi-conservative model of DNA replication, how many of the resulting DNA…

A: Semi conservative replication The replication of DNA is semi conservative in nature because the…

Q: Describe the early models of DNA replication that were investigated and explain how research by…

A: For DNA replication, three models were proposed: conservative, semi-conservative, and dispersive.…

Q: II. Discuss the following aspects of transcription: 1. What is meant by monocistronic or…

A: Transcription has three phases: initiation, elongation, and termination. In eukaryotes, RNA…

Q: Why is replication important?

A: REPLICATION - it the process of forming copy.

Q: Arrange the events of replication chronologically from A (first) to G (last event): -Sealing of…

A: Replication is the process in which duplication of DNA takes place inside the nucleus. this process…

Q: Shown below is a double stranded DNA molecule.Replicate this DNA and show the products formed from…

A: DNA REPLICATION :- It is the process by which DNA makes a copy of itself during cell division. The…

Q: Describe the semi-conservative nature of DNA replication.

A: DNA (deoxyribonucleic acid) is the hereditary unit of an organism. DNA is formed of nucleotides…

Q: 10

A: DNA replication is a process by which new copy of DNA molecules are made by DNA polymerase.

Q: 3b) During DNA replication, one new DNA strand is synthesized continuously but the other strand is…

A: DNA is a long polymer of nucleotides which makes the genetic material of most of the living organism…

Q: TRUE OR FALSE: a) Okazaki fragments are short DNA pieces that explain how the DNA polymerase can…

A: DNA replication process is semi conservative. The semi conservative replication of DNA refers to the…

Q: Why is DNA replication considered semi-conservative? answer this in a few sentences (short answer)…

A: Introduction: There are two different kinds of nucleic acids in living things. Deoxyribonucleic acid…

Q: The following diagrams represent DNA molecules that are undergoing replication. Draw in the strands…

A: Replication is bidirectional and originates at a single origin of replication ( Ori C ). Takes place…

Q: In the diagram of replication shown here, ﬁll in the blanks with the appropriate terms: (a) base…

A: Transmission of chromosomal DNA from generation to generation is crucial to cell propagation. This…

Q: What enzyme synthesizes small primers for DNA polymerase to bind to so it can initiate DNA…

A: DNA replication is the first process in the central dogma of life. It involves the synthesis of new…

Q: List and describe the steps in prokaryotic DNA replication. How does this process appear to differ…

A: DNA replication is the process in which the the double helical structure will act as a template for…

Q: The process of DNA replication is affected by an enzyme known as: (a) Mutase (b) Ligase (c)…

A: The process of replicating a double-stranded DNA molecule into two identical DNA molecules is known…

Q: Consider the following segment of DNA, which is part of a linear chromosome: LEFT…

A: DNA replication is the process by which the DNA is copied in the cell to make up more number of DNA…

Q: Why do we say that DNA replication is semiconservative?

A: DNA is the chemical name for the molecule that carries genetic instructions in all living things.

Q: Explain and demonstrate the steps in DNA replication using a replication fork. Replicate 10…

A: DNA is a double stranded molecule made by nucleotides of which opposite strands are linked rogether…

Q: 6. replication? To answer the question please: idraw a scheme of DNA replication and mark the…

A: DNA replication: a. It is the reaction in which the daughter DNA is synthesized using the parental…

Q: The double helix structure of deoxyribonucleic acid (DNA)

A: The characteristic features of an individual is controlled by the genes in DNA. The arrangement of…

Q: . Indicate the role of each of the following in DNA replication: (a) topoisomerase, (b) helicase,…

A: The deoxyribonucleic acid (DNA) is a hereditary material that is found in almost all living…

Q: describe the function of Helicase, and DNA Polymerase in the DNA replication process.

A: DNA helicases are fundamental during DNA replication since they separate double stranded DNA into…

Question

(a) What is the function of helicase in DNA replication?
(b) What is the function of DNA polymerase?
(c) What are replication forks? Compare and contrast leading and lagging strands.

Answer all please

Definition Definition Mechanism by which deoxyribonucleic acid (DNA) is capable of producing an exact copy of itself. DNA molecules utilize a semiconservative method for replication. DNA replication is the most essential part of biological inheritance and is crucial for cell division during growth and repair of damaged tissues.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

Step 2

Step 3

Step 4

Trending now

This is a popular solution!

Step by step

Solved in 4 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

A seiee hserved under a microscope, researchers observe that the DNA is able to be SE be replicated. Based on this observation, which protein involved in DNA replication is most likely mutated? To answer the question please: I) draw a scheme of DNA replication; 2) name the proteins that are required for DNA replication; 3) propose the consequences of the process.
Semi-conservative replication means (a) when DNA is replicated it consists one old strand and one new strand (b) the strands are anti-parallel (c) the strands are complementary (d) A=T, G=C (e) none of the above
Describe the functions of the following proteins during DNA replication: (i) Polymerase epsilon (ii) Polymerase alpha (iii) Dna A (iv) Telomerase
Which of the following items do not affect the melting temperature of DNA? A) length of the DNA the type of polymerase used to amplify the DNA (C) salt content surrounding the DNA D) nucleotide composition of the DNA E) the type of DNA (genomic versus CDNA)
1. In a sample solution given for analysis; CATAGCTTTGTTAAA (DNA nucleotide chain). a) Show the 5 'and 3' ends by writing in triplet (codon) form. Find the number of Hydrogen bonds in the double helix DNA strand at the beginning. b) Find the peptide sequence that this DNA chain will synthesize and show the energy balance required for its synthesis and indicate its total load at physiological pH. c) How do you prove that this peptide sequence is as above? Explain.
The statement “DNA replicates by a semiconservative mechanism” means that (a) only one DNA strand is copied (b) first one DNA strand is copied and then the other strand is copied (c) the two strands of a double helix have identical base sequences (d) some portions of a single DNA strand are old and other portions are newly synthesized (e) each double helix consists of one old and one newly synthesized strand
Describe the functions of the following proteins during DNA replication: (i) Polymerase I (ii) DnaA (iii) Telomerase
TACCCCGAGTCCCTGGCGTTAAAACAGTGCCGAATC
The following diagram represents a DNA molecule that is undergoing replication. Draw in the strands of newly synthesized DNA and identify (a) the polarity of the newly synthesized strands, (b) the leading and lagging strands, (c) Okazaki fragments, and (d) RNA primers.
After Step 1: As DNA replication takes place, nucleosomes assemble rapidly on newly formed daughter DNA molecules. The “new” nucleosomes are a mixture of old (recycled) and newly formed histones, distributed randomly on the two daughter DNA molecules, what is the next step of nucleosome formation during DNA replication?
During DNA replication, the proteins that ensure denatured templates are not re- natured are called .......... ........and the protein that connects the fragmented pieces of DNA in the lagging (discontinuous) strand is called............ I A
Number the steps of DNA replication in the correct order (1, 2, 3) a) ______ Polymerase travels down the DNA parent strand b)______ DNA strands are unzipped c) ______ Ligase binds Okazaki fragments together