The mutation associated with pancreatic cancer in the family was located in an exon of the palladin gene. In general, would you expect to find more cancer-causing mutations in exons or in introns? Explain your answer.
Q: From the previous question regarding the insertion of an A base into the template strand: will this…
A: The transcription is the process of RNA synthesis from the DNA template. It is the first step of…
Q: Which of the following gene mutations is most likely tohave the most severe impact on gene…
A: Eukaryotic genome is usually larger than prokaryotic genome. This is because of the presence of…
Q: Will an insertion or a deletion of three nucleotides result in a frameshift mutation? Explain why or…
A: The frameshift mutation is the mutation by which the amino acid frame is changed. It is usually…
Q: Cystic Fibrosis is caused by a mutation in the CFTR gene, and an ideal form of treatment would be to…
A: Cystic fibrosis is an inherited life threatening disorder that causes severe damages to lungs,…
Q: mutation in a gene’s exons is more damaging than a mutation in a genes intron. Do you agree or…
A: DNA sequences consists of two parts exons and introns. Exon is that part of the DNA which directly…
Q: Explain why cell biologists predicted that the genetic code would be based on a 3-base codon.…
A: The genetic code is the precise sequence of DNA nucleotides read as three-letter words or codons…
Q: TP53 encodes the p53 tumor suppressor gene and is the most mutated gene in cancer with 50% of…
A: Any abnormality in chromosome structure during G1 phase cell cycle is captured by the protein called…
Q: Two eukaryotic proteins have one domain in common but areotherwise very different. Which of the…
A: Eukaryotes are organisms whose cells have a nucleus enclosed within a nuclear envelope. Eukaryotes…
Q: If the genetic code were overlapping, how many complete codons would the followingsequence encode…
A: The process by which mRNA is translated to the amino acid sequence is termed as translation. It…
Q: Would a deletion of two base pairs have a greater consequence if it occurred in an intron rather…
A: Would a deletion of two base pairs have a greater consequence if it occurred in an intron rather…
Q: Imagine if there were 200 commonly occurring amino acids instead of 20. Given what you know about…
A: Introduction: 20 amino acids make up all the proteins. These are the building blocks of proteins…
Q: In the treatment of cancer, the basis for many types of chemotherapyand radiation therapy is that…
A: The tumor is irregular growth of tissue. It is the first stage of tumor development. The…
Q: If the nonsense mutation is in the last exon of the mRNA, the result would be:
A: Exons are sections of an RNA transcript, that code for a protein. Exons are separated by non-coding…
Q: Give two DIFFERENT examples of how the following can occur: a. A point mutation in an exon that is…
A: Silent mutation - Silent mutations are mutations in DNA that do not have an observable effect on the…
Q: With regard to transcriptional termination in eukaryotes, which model suggests that RNA polymerase…
A: After RNA polymerase II has transcribed the polyadenylation, which is the process of cleaving the 3’…
Q: Refer to a genetic code table for the question. below is a portion of the template strand of a…
A: The genetic code is a set of three-letter combinations of nucleotides called codons, each of which…
Q: I would like to know how you find the non-transcribed DNA sequence when you are given a 5 prime to 3…
A: The central dogma of molecular biology explains the flow of genetic information through the…
Q: Exon shuffling is a proposal that relates exons in DNA to the repositioning of functional domains in…
A:
Q: The length of a particular gene in human DNA, measured from the start site for transcription to the…
A: Transcription is a process of formation of transcript or RNA from DNA by the process of…
Q: Suppose the gene that produced this mRNA happens to mutate so that one of the codons in the middle…
A: Nucleic acids are the carrier of genetic information in the cells. DNA is the carrier of genetic…
Q: Mutations that introduce stop codons cause a number of genetic diseases. For example, from 2% to 5%…
A: Non-sense mediated mRNA decay (NMD) is a technique evolved by the eukaryotic cells to prevent the…
Q: Why might a single base-pair mutation in eukaryotic mRNA be less serious than one in prokaryotic…
A: Single base pair mutation in mRNA transcript in Eukaryotes is less serious because mRNA of Eukarotes…
Q: Some mutations affect changes in protein structure and function that can result in disease whereas…
A: Proteins are synthesized from gene expression. They are coded by the genes and translated to form…
Q: Let’s suppose that a vertebrate organism carries a mutation that causes some cells that normally…
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: Mutations that introduce stop codons cause a number of genetic diseases. For example, from 2% to 5%…
A: Non-sense mediated mRNA decay (NMD) is a technique evolved by the eukaryotic cells to prevent the…
Q: Suppose the DNA sequence of a gene with 5 exons contains a mutation at the 5’ end of intron 2.…
A: The protein translation is the process of the formation of proteins from the mRNA formed from the…
Q: Original strand: G G G C T A G G G C C A A , Mutant strand: G G G G C T A G G G C C A A . What type…
A: According to our guideline we can answer only the first three subparts of a question. So, please…
Q: You found amutation in this gene(see below). Which part of the gene is the mutation in (exon,…
A: The deletion mutation is a type of mutation which involves the loss of genetic material during…
Q: Use the information uploaded in the picture to help with this question. Would you conclude that…
A: through Ames test we can check whether the compound is mutagenic or not.
Q: do introns or 3′ untranslated regions of a gene have higher rates of nucleotide substitution?…
A: Introns are the regions that include non-coding regions of the RNA transcript. The introns are…
Q: Give two examples of places you could have mutations in the DNA sequence of a eukaryotic gene that…
A: The change in the heritable characteristics of the species across many generations is called…
Q: Let us suppose that a vertebrate organism carries a mutation that causes some cells that normally…
A: The addition of methyl groups into DNA molecule is called DNA methylation. The activity of the DNA…
Q: How many possible mRNAs could be derived from a gene with three exons (exon 1, exon 2, and exon 3)?…
A: Transcription is a process in which one strand of DNA known as template strand is known as converted…
Q: Refer to the following illustration to answer the question. mobile genetic elements exon 1A…
A: Transposable genetic element are the DNA sequences which can shift their original locations and…
Q: Some mutations affect changes in protein structure and function that can result in disease whereas…
A: Hi! Thanks for your question. But as you have posted multiple questions, I am answering the first…
Q: Consider the following sequence of DNA: 3' - TACATGIIGTAG-5' a) Create a nonsense mutation with the…
A: DNA contains the genetic information for the physical characteristics of the human body. The DNA…
Q: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences…
A: Given DNA strand: 5' - CCTATGCAGTGGCCATATTCCAAAGCATAGC - 3'
Q: If the codon AAA is mutated to AAG, it still codes for the amino acid, lysine, and the protein…
A: Mutations are the changes in the genes of the cell that causes abnormalities in the structure and…
Q: Which type of mutation in telomerase is associated with cancer cells? a. Mutations that produce an…
A: A mutation is an alteration or change in a deoxyribonucleic acid (DNA) sequence. Mutations can…
Q: This is a list of molecular changes that could happen during DNA replication, transcription, mRNA…
A: The mutation alters allele frequencies by constantly introducing new alleles, which can be…
Q: Suppose you are studying two different mutations in a gene that codes for a protein. In the first, a…
A: Proteins are made up of amino acids that joins together by peptide bonds. The synthesis of protein…
Q: A certain Drosophila protein-encoding gene has one intron. If a large sample of null alleles of this…
A: Introduction :- Any nucleotide sequence within a gene that is deleted by RNA splicing during the…
Q: What is the survival value of the degeneracy of the genetic code? – Define what degeneracy means and…
A: Introduction :- The genetic code is made up of codons, which are three-letter nucleotide pairings…
Q: Below is the 5'-3' strand of a double-stranded DNA molecule with the following nucleotide sequences:…
A: Here i discuss about the coding strand, antisense strand of DNA, their transcribed products as well…
Q: What do you predict that you would find when comparing the mRNA and protein products of the mutated…
A: Spinal muscular atrophy(SMA) SMA is characterized by the loss of motor neurons, nerve cells in the…
Q: a molecular geneticist hopes to find a gene in human liver cells that codes for an important…
A: As given in the question, there is a particular gene in the human liver cells that quotes for an…
Q: Are the 5′ untranslated regions (5′ UTR) of eukaryotic mRNAs encoded by sequences in the promoter,…
A: The 5′ UTR is located in the first exon of the gene.
Q: An alteration in a nucleotide sequence that changes a triplet coding for an amino acid into a…
A: The deoxyribonucleic acid is the genetic material that is passed from one generation to the next…
The mutation associated with pancreatic cancer in the family was located in an exon of the palladin gene. In general, would
you expect to find more cancer-causing mutations in exons or in
introns? Explain your answer.
Step by step
Solved in 2 steps
- You take DNA samples from a family with a history of the genetic disease spinal muscular atrophy, which results from many different mutations in the SMA gene. One mutation in the SMA gene is a 240-bp in-frame deletion mutation in the middle of an exon. Data from this family shows you that several individuals from the family have this mutation. What do you predict that you would find when comparing the mRNA and protein products of the mutated and unmutated SMA gene? Select all that apply. 1. The mRNA from the SMA is more stable than unmutated SMA mRNA. 2. The pre-mRNA from the SMA mutant is shorter than the unmutated SMA pre-mRNA. 3. The mature mRNA from the SMA mutant is longer than the unmutated SMA mRNA. 4. The protein from the mutated SMA is shorter than the unmutated SMA protein.You may wish to consult the genetic code above to answer the following question. A mutation has changed a portion of a protein coding gene that encodes a messenger RNA sequence. The original messenger RNA sequence is 5-AUGCCCAGAGCU-3' Which mutation is a nonsynonymous (missense) mutation that changes a single amino acid in the encoded protein? O 5-AUGCCCAGGGCC-3' O 5'-AUGCCCUGAGCU-3' O 5'-AUGCCCACAGCU-3 5'-AUGCCCCAGAGCU-3A protein is normally secreted from the cell. A team of scientists attempts to redirect this protein to the inside of the nucleus by mutating the sequence of the gene. Unfortunately, after this mutation, the protein is no longer secreted, but it is now localized to the cytosol and not the nucleus. Briefly answer the two questions below: Identify the sequence that was mutated by the scientists and explain your reasoning. a. b. What additional mutation must be made by the scientists to redirect this protein to the nucleus? Explain your reasoning.
- Geneticists have found that when they cut out a eukaryotic gene from genomic DNA that they can hybridize one of the strands of that gene to the mRNA for that gene by allowing the strands to hydrogen bond. Why did the appearance of these hybridized strands provide evidence of the existence of introns in eukaryotic genes?What common mutation occurs in many human cancers? Explain how it can have this effect.a molecular geneticist hopes to find a gene in human liver cells that codes for an important blood-clotting protein. he knows that the nucleotide sequence of a small part of the gene is gtggactgaca. briefly explain how to obtain the desired gene answer
- The figure below shows the introns and exons found in gene X. The size of each exon and intron is shown as well. A study on this organism found that two mature mRNA molecules are produced for this gene. One is 457 nucleotides in length, and the other is 439 nucleotides in length. Name the process responsible for producing this variation. Also explain how these 457 and 439 nucleotide fragments were produced by referring to the information provided. Hint: This organism produces a poly-A tail of 120 nucleotides.The figure below shows the introns and exons found in gene X. The size of each exon and intron is shown as well. A study on this organism found that two mature mRNA molecules are produced for this gene. One is 457 nucleotides in length, and the other is 439 nucleotides in length. Name the process responsible for producing this variation. Also explain how these 457 and 439 nucleotide fragments were produced by referring to the information provided. Hint: This organism produces a poly-A tail of 120 nucleotides. 99 62 120 84 102 27 117 Gene X E1 11 E2 12 ЕЗ 13 E4 Exon (E) Intron (I)The figure below shows the introns and exons found in gene X. The size of each exon and intron is shown as well. A study on this organism found that two mature MRNA molecules are produced for this gene. One is 457 nucleotides in length, and the other is 439 nucleotides in length. Name the process responsible for producing this variation. Also explain how these 457 and 439 nucleotide fragments were produced by referring to the information provided. Hint: This organism produces a poly-A tail of 120 nucleotides. 99 62 120 84 102 27 117 Gene X E1 в в 11 E2 12 E4 Exon (E) Intron (1)
- There are dozens of common variations of the c-myc gene, which are associated with different types of cancer. Here are 3 variations of part of a sequence of the c-myc gene, located between nucleotides 180 and 201. The original sequence is given to you, as well as the sequences of 3 variations. The mutated nucleotide of each variation is annotated in gray. Use this information (picture) to answer the next two (2) questions 1. Which of the c-myc variations is least likely to cause a change in c-myc function?2. Which variation of c-myc produces a nonsense mutation?Let’s suppose that a vertebrate organism carries a mutation that causes some cells that normally differentiate into nerve cells to differentiate into muscle cells. A molecular analysis reveals that this mutation is in a gene that encodes a DNA methyltransferase. Explain how an alteration in a DNA methyltransferase could produce this phenotype.Trichothiodystrophy is a human inherited disorder characterized by premature aging, including osteoporosis, osteosclerosis, early graying, infertility, and reduced life span. The results of studies showed that the mutation that causes this disorder occurs in a gene that encodes a DNA helicase. Propose a mechanism for how a mutation in a DNA helicase might cause premature aging. Be sure to relate the symptoms of the disorder to possible functions of the helicase enzyme.