Let’s suppose that a vertebrate organism carries a mutation that causes some cells that normally differentiate into nerve cells to differentiate into muscle cells. A molecular analysis reveals that this mutation is in a gene that encodes a DNA methyltransferase. Explain how an alteration in a DNA methyltransferase could produce this phenotype.

Q: Much of DNA methylation in eukaryotes occurs at CpG dinucleotides, but some individual cytosine…

A: Epigenetics of gene expression allows heritable changes in gene expression without altering the DNA…

Q: Give an example of a mutagen that can change cytosine to uracil.Which DNA repair system(s) would be…

A: Introduction: Chemical compounds or radiation that possess the ability to cause heritable and…

Q: There are dozens of common variations of the c-myc gene, which are associated with different types…

A: The mRNA is produced from the DNA by the transcription process and this mRNA is used for the protein…

Q: In the absence of this enzyme, a substance called ceroid lipofuscin accumulates in lysosomes in the…

A: Batten disease is also known as neuronal ceroid lipofuscinoses. Batten disease is an autosomal…

Q: How do dietary factors interact with DNA methyltransferase to affect an organism's phenotype in an…

A: The modulation of gene expression via processes other than the DNA coding sequence is referred to as…

Q: Certain repeated sequences in eukaryotes are flanked by short direct repeats, suggesting that they…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: "The molecule serving as the genetic material is expected to absorb at the wavelengths shown to be…

A: DNA is a double-stranded molecule with helical structure. It has made of nucleotides containing four…

Q: Covalent modification of eukaryotic DNA is an important regulator of gene expression. Name one type…

A: Covalent modifications can be described as a alteration in the activity of enzyme, DNA and protein,…

Q: Suppose that the diagram below represents the genomic organization of an enzyme involved in eye…

A: Transcription is the process by which  RNA transcript is formed from DNA. Various type of RNA are…

Q: You are studying a human cancer cell line and you notice that you see the normal amount of RNA but…

A: INTRODUCTION Mutation Mutations are the sudden heritable changes in the genetic material occur due…

Q: Most of the mutations that Yanofsky recovered were missense mutations. However, Yanofsky also…

A: Hypothesis is basically a proposed explanation for any naturally occurring phenomenon in the…

Q: Trinucleotide repeat expansions (TNREs) are associated with severaldifferent human inherited…

A: The trinucleotide repeat expansion is also called triplet repeat expansion. It is a DNA mutation and…

Q: Some antibiotics, such as rifampin, interfere with the function of RNA polymerase. What biological…

A: Antibiotic is a substance released by any microorganism against other microorganism. These…

Q: DNA methylation is considered an epigenetic phenomenon because the pattern of methylation can be…

A: Epigenetics is considered as a study of certain gene expressions, which is heritable.

Q: In the corn snake Pantherophis guttatus, there are several different color variants, including…

A: Introns are non-coding sequences and exons are coding sequences in the gene. Splicing is the process…

Q: Oxidation of DNA bases is mutagenic. An oxidized form of guanine,8-oxoguanine, can base-pair with…

A: A base analog has a similar structure to that of a normal base and causes mispairing between bases.…

Q: Genes involved in DNA to protein route are highly conserved in comparison to genes of enzymes that…

A: Deoxyribonucleic acid (DNA) is a biomolecule found in nearly all living organisms. DNA used as…

Q: How many of the mutations listed below would lead to excessive cell growth when the cell was either…

A: Excessive growth occurs when a cell continuously divides and when there is no cell cycle arrest. Myc…

Q: Practice Question 3 B) In hybrid A what are the large loops seen on the top strand of DNA? What are…

A: Hybrid DNA is formed from complementary single DNA strands from two different parental molecules.…

Q: Higashi et al. (1986) found that three critical mutations were found in one of the two genes coding…

A: The synthesis of RNA from DNA is called as transcription and the synthesis of proteins with the help…

Q: The E. coli genome contains approximately 4639 kb. (a) How many copies of the 6-bp recognition…

A: E.coli is a type of bacteria that normally lives in the intestine. It is also found in the gut of…

Q: You obtain the sequence of a gene containing 10 exons, 9 introns, and a 3'-UTR containing a…

A: A gene is a stretch of nucleotides present on a chromosome. It is the region that encodes the…

Q: Adjacent pyrimidine bases in DNA form dimers with high efficiency after exposure to UV light. If…

A: Skin tanning is the process in which the skin color is darkened as a result of exposure to…

Q: One mutation is a deletion of six nucleotides in the second exon of the gene and the other mutation…

A: Introns and exons are nucleotide sequences within a gene in mRNA. The conversion of DNA to RNA is…

Q: Once transcribed, the length of the mRNA for gene X is usually 1000 nucleotides long in your…

A: Rho utilization site , also known by the acronym rut is a sequence of RNA in bacteria upstream of…

Q: You are studying a mutation in mice, which acts dominantly. Mice that have only one copy of the…

A: Definition Mutations are changes in DNA sequence. it can result from DNA copying mistakes , made…

Q: Scientists have observed that individuals with LOW birthweight are MORE likely to become obese as…

A: The experiment performed to observed that individuals with LOW birthweight are MORE likely to become…

Q: a. Identify the sequence that was mutated by the scientists and explain your reasoning. b. What…

A: Ans) a)A mutant protein is the protein product encoded by a gene with mutation. Mutated protein can…

Q: DNA methylation is considered an epigenetic phenomenon because the pattern of methylation can be…

A: Epigenetics refers to the phenomenon where traits can be inherited through reverdible changes in…

Q: Cystic fibrosis (CF) is an inherited disorder caused by different types of mutations, many of which…

A: CF is caused by a mutation in a gene called the cystic fibrosis transmembrane conductance regulator…

Q: A protein is normally secreted from the cell. A team of scientists attempts to redirect this protein…

A: Mutation can be defined as a change in the DNA sequence of a gene. In this case, a team of…

Q: In the absence of this enzyme, a substance called ceroid lipofuscin accumulates in lysosomes in the…

A: CRISPR is a DNA sequence that found in prokaryotic organism's genome like bacteria , archaea.…

Q: Galactosemia is a metabolic disorder characterized by the inability to metabolize the sugar…

A: Galactosemia It is a rare genetic metabolic disorder that affects how the body processes a simple…

Q: ncer where the newly-discovered genes BR and AIN are known to play a role in the development of this…

A: Cancer results from the uncontrolled cell division giving rise to a lump of cells that may be…

Q: Given the following sequence of a coding DNA strand: AGTTGCGCATGCCAGAGAGGTTCGAGTGCACATAACTTGAG The…

A: DNA is a double stranded molecule with coding strand and template strand. Template strand is the one…