Suppose that a gene underwent a mutation that changed a GAA codon to UAA. (a) Name the amino acid encoded by the original triplet. (b) Identify a tRNA anticodon that could translate the nonsense UAA triplet. (c) What other amino acid could be encoded by the mutant tRNA?

Suppose that a gene underwent a mutation that changed a GAA codon to UAA. (a) Name the amino acid encoded by the original triplet. (b) Identify a tRNA anticodon that could translate the nonsense UAA triplet. (c) What other amino acid could be encoded by the mutant tRNA?

Name: Suppose that a gene underwent a mutation that changed a GAA codon to U
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: Suppose that a gene underwent a mutation that changed a GAA codon to UAA. (a) Name the amino acid encoded by the original triplet. (b) Identify a tRNA anticodon that could translate the nonsense UAA triplet. (c) What other amino acid could be encoded

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter10: From Proteins To Phenotypes

Section: Chapter Questions

Problem 20QP: If an extra nucleotide is inserted in the first exon of the beta globin gene, what effect will it...

See similar textbooks

Similar questions

How does the cell ensure that a specific amino acid (say, valine) attaches itself only to the one tRNA molecule that is specific for valine? (A) Proteins called aminoacyl DNA synthetases are responsible for bringing together the proper pair. The enzymes match the amino acid and one of the correct DNA molecules carrying the right anticodon. (B) Lipids called aminoacyl tRNA synthetases are responsible for bringing together the proper pair. The lipid binds the amino acid and one of the correct tRNA molecules carrying the right codon. (C) Enzymes called aminoacyl tRNA synthetases are responsible for bringing together the proper pair. The enzymes match the amino acid and one of the correct tRNA molecules carrying the right anticodon. (D) Enzymes called peptidyl mRNA synthetases are responsible for bringing together the proper pair. The enzymes match the amino acid and one of the correct mRNA molecules carrying the right anticodon.
The protein Xpot transports tRNAs out of the nucleus so that they can be aminoacylated in the cytosol. (a) What tRNA structural features is Xpot likely to recognize? (b) How does Xpot distinguish mature tRNAs from pre-tRNAs?
The genetic code is thought to have evolved to maximize genetic stability by minimizing the effect on protein function of most substitution mutations (single-base changes). We will use the six arginine codons to test this idea. Consider all of the substitutions that could affect all of the six arginine codons.(a) How many total mutations are possible?(b) How many of these mutations are “silent,” in the sense that the mutantcodon is changed to another Arg codon?(c) How many of these mutations are conservative, in the sense that an Argcodon is changed to a functionally similar Lys codon?
A segment of DNA has the followimg sequence of bases.. 5'-ATGCAATGATATTGAAGCTTA-3' a) What sequence of bases would appear in mRNA transcribed from this segment? b) Assume the first base in this mRNA is the beginning of a codon. What order of amino acid would be translated into a polypeptide synthesized along this segment? c) Give anticodons for each tRNA associated with the translation in part (b)
a) Examine the nucleotide sequence below, and determine the amino acid sequence encoded by this mRNA. (2) 5' CCUCCGGACCGGAUGCCCGCGGCAGCUGCUGAACCAUGGCCCGCGGGUGAGCCAAGGAGGAGGGC 3' b) What would be the consequence of a mutation that resulted in changing the underlined nucleotide to a G? (2) Second base U G. Consensus sequences functioning in transcription or translation (5-3): UGU UAU UCU Phe UCC Ser UCA Leu UCG UUU Tyr Cys TATA box (-25) TATAAA UUC UAC UGC UAA Stop UGA Stop A UAG Stop UGG Trp G UUA TFIIB recognition element /c/c/¢CGCC UUG TATAAT CGU CAU His CAC Pro CAA Gln CAG -10 (Pribnow) sequence CUU CCU CC Leu CCA CGC Arg CGA CUC TTGACA -35 sequence CỦA CUG CCG CGG Shine-Dalgarno sequence (Ribosome binding site) UAAGGAGGU YYANT/AYY AGU Asn AGC AUU ACU AAU Ser Initiator element AUC lle ACC Thr AAC AGA Lys AGG AUA ACA AAA lA AGLGU ^/G AGU Arg Intron 5' splice site AUG Met ACG AAG CAGIG GGU GAU Asp GAC Intron 3' splice site GCU GUU GCC Val GCA GGC Gly GGA GUC AAUAAA Ala Cleavage site…
A tRNA is charged with the amino acid methionine.(i) Give the anti-codon of this tRNA.(ii) Write the Codon for methionine.(iii) Name the enzyme responsible for binding of amino acid to tRNA
Sickle cell disease is caused by a so-called “point mutation" in the human B-globin gene. A point mutation is the result of a single base substitution in the DNA encoding a gene. The sickle cell mutation results in substitution of Val for Glu at position 6 in the B-globin protein. (a) Using the information in Figure 5.18 explain how a point muta- tion could change a codon for Glu to a codon for Val. (b) Do you expect the pI for the sickle cell B-globin to be higher or lower than the pl for wild-type B-globin? Explain.
Which of the following is not true? A.) A single activating enzyme can interact with all the tRNAs for its corresponding amino acid B.) The selectivity of the aminoacyl-tRNA sunthetases for their tRNA molecules is oftern called the second Genetic code C.) There are two major classes of aminoacyl-tRNA syntetases D.) Aminoacyl-tRNA synthetases link amino acids to tRNA molecules without the need for an energy source
We have a eukaryotic full-length mRNA molecule consisting of 33 bp5ʹ -... ACGAUACGUAUGCUCGAGAUCCGAGACUAUGUU ...- 3ʹ a) What are the first five amino acids that are translated? b) Describe how the ribosome finds the translation start on the mRNA transcript from prokaryotic and eukaryotic genes, respectively.
a) The deacetylation of histones generally causes gene inactivation. True or false? b)During eukaryotic translation, the first contact between the ribosome and the mRNA is usually made when the small ribosomal subunit directly binds to the translational start site (Kozak sequence) on the mRNA. True or false? c)The termination of translation is carried out by a single tRNA molecule that recognizes all three stop codons. True or false? d) The deamination of cytosine, which produces uracil, is less likely to be repaired, compared to the deamination of 5-methylcytosine, which produces thymine.True or false? e)An HLH-bHLH heterodimer can bind DNA. True or false? F)Chromatin remodeling complexes posseses ATPase activity. True or false? g)Histone methylation generally causes gene inactivation. True or false? h) A pre-mRNA is cleaved downstream of its polyA signal before the transcription terminates. True or false? i) During X chromosome inactivation in female mammals, most genes are repressed…
Sickle cell anemia is a widespread disease in many African countries and can be caused by a change in the amino acid sequence from glutamic acid to valine. A patient is diagnosed with the disease and a genetic fingerprint reveals the following DNA sequence for the gene: (a) (b) (c) (d) (e) Write down the mRNA sequence for the given DNA sense strand indicating the polarity. Derive the polypeptide from the mRNA molecule using the table of the genetic code (Table Q1 below) again indicating the polarity of the peptide chain. Indicate the position in the DNA molecule that could have caused the disease and write down all possible point mutations in the DNA sequence that could have caused it. [ The polypeptide chain is polymerized at the ribosomes using t-RNA molecules. Write down all possible t-RNA molecules with their anti-codons that are used to polymerize the amino acid VAL. Indicate the polarity. 3'-TAC TGA GCA AGA TTA CAT ACT-5' Explain what is meant by redundancy of the genetic code.…
A polypeptide has 51 amino acids in its primary structure. (i) What is the minimum number of DNA bases required to code for the amino acids in this polypeptide. Show your calculation. (ii) Does AUG appear in the first three nucleotides in the mRNA coding for this mRNA? Explain why.