Enzymes, proteins and deoxyribonucleic acid (DNA) are important biological macromolecules. Enzymes are not only speed up the reaction, but also are necessary for DNA repraduction. a) Compare the process of protein synthesis between eukaryote mRNA and viral RNA b) With the aid of a diagram, draw an adapter molecule that recognizes the codons of mRNA and explain its functions in DNA translation.

Q: The base sequence on one strand of DNA is ATGTCTATA(i) Give the base sequence of its complementary…

A: The deoxyribonucleic acid is the genetic material that is passed from one generation to another…

Q: Distinguish between (a) unidirectional and bidirectional synthesis, and (b) continuous and…

A: Answer- DNA replication or synthesis of DNA is the formation of DNA from the parental strand in the…

Q: The function of RNA polymerase is to A) catalyze the formation of phosphodiester bonds between…

A: Gene expression is the process thorough which the DNA directs to form proteins. It involves two…

Q: Gene Expression: 14) Look at the diagram: a) For each of the molecules in the diagram, identify what…

A: Q. Ans:- Gene expression:- Gene expression is a term that explains that a nucleotide sequence known…

Q: Define the following terms: genetic code, codon, and anticodon. What is the relationship among the…

A: DNA is the storehouse of information in living organisms. It is present inside the nucleus of every…

Q: Several different nucleic acids are involved in the process of getting a protein produced from a…

A: Sense strand is that strand of DNA double helix which has the translatable protein code in the 5'-3'…

Q: b) Draw a diagram to show how nucleotides are organised in the structure of DNA. Note: You need only…

A: The four most important biomolecules in living things are carbohydrates, amino acids, lipids, and…

Q: Distinguish between DNA and RNA on the basis of following:  a) chemically  b) functionally  c) by…

A: DNA and RNA are nucleic acids found in all living organisms. DNA is the short form of…

Q: Spliceosomes play central roles in .. a) removal of exons from pre-mRNA b) removal of introns from…

A: The mRNA transcribed from the DNA is heterogeneous mRNa or pre mRna which is not the final product.…

Q: Match the function in translation to each type of RNA (one RNA has two listed functions). 1) Carry…

A: The process where RNA transformed into protein called translation. There are all three types of…

Q: 16) PROTEIN SYNTHESIS: A) Describe the process of protein synthesis. Be sure to use transcription…

A: Proteins are polymers of amino acids formed via peptide bond between two amino acids .

Q: All of these materials are needed for translation EXCEPT: O A) TRNA O B) ribosomes C) RNA polymerase…

A: Translation, in molecular genetics, is the mechanism by which ribosomes in the cytosol or…

Q: Consider a portion of a gene in a cell with the sequence TTTTT. Which of the following bases would…

A: The correct answer is C) A-A-A-A-A; nucleus .

Q: If DNA codes for mRNA and mRNA codes for protein, then how can the same DNA sequence generate…

A: If DNA codes for mRNA and mRNA codes for protein, then how can the same DNA sequence generate…

Q: Translate this DNA sequence using Genetic Code 5' - ATG GGG cCC GTC CAT CCG TAC GCC GGA ATT ATA - 3'…

A: DNA is transcribed into mRNA through the process of transcription. mRNA is then translated into…

Q: The ribosome has 3 tRNA binding binding sites. They are    a)     EF1, EF2, and EF3   b)     1, 2,…

A: Ribosomes are the molecular machines that synthesize proteins. They are composed of two subunits a…

Q: A ribosome binds to the following mRNA at the site indicatedby the dark box. At which codon will…

A: The mRNA strands obtained after the transcription of the antisense DNA strand (also known as the…

Q: Which of the following is a function of TRNA? O A) brings one amino acid to the ribosome B)…

A:

Q: Translation requires energy what step(s)? please explain answer B) 30S ribosome subunit binding C)…

A: Translation is the process that involves production of polypeptide chain from the mRNA (messenger…

Q: Illustrate the process of translation by providing the correct bases for tRNA strand given the mRNA…

A: The genetic code includes the information on DNA for the protein made from RNA, which is called gene…

Q: Below is a template strand of DNA. Assume the transcription start site is outside of this sequence…

A: Transcription is the initial phase in gene expression, where data from a gene is utilized to develop…

Q: A eukaryotic mRNA has 1066 total nucleotides. 50 of these are the 5'UTR and 50 of these are the…

A: In a mature transcript, there are 5' untranslated (UTR) regions and 3' UTR which do not code for any…

Q: The process of translation involves three distinct phases: initiation, elongation, and termination.…

A: Translation is the process by which a protein is synthesized from the information contained in a…

Q: ) The deacetylation of histones generally causes gene inactivation. True or false?

A: Since you have asked multiple question, we will solve the first question for you. If you want any…

Q: The following is a portion of an mRNA sequence:   3’ –AUCGUCAUGCAGA-5’ a)During transcription, was…

A: The synthesis of RNA (ribonucleic acid) from DNA (deoxyribonucleic acid) by the enzyme RNApolymerase…

Q: After translation a protein needs to be folded correctly in order to function properly: C) What…

A: Proteins are long chains of amino acids. There are 4 types of proteins based on their structure:…

Q: Geneticists have found that when they cut out a eukaryotic gene from genomic DNA that they can…

A: Splicing  The removal of introns (non coding part of gene) from pre mature RNA.

Q: For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: b) the sequence of the…

A: The given DNA sequence is as follows 3’–CGATACGGCTATGCCGGCATT–5' The above given strand is a…

Q: The Human Genome Project showed that human DNA is not considerably bigger than much simpler…

A: A genome is all the DNA in an organism, including its genes. Genes carry information for making all…

Q: Which of the following is not true with respect to RNA?   a). A single-stranded chain of…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: How to transfer biological information in protein synthesis? What is the link between DNA and…

A: Central Dogma is a flow of information that is present in the form of nucleotide sequence on the DNA…

Q: During translation elongation, in which site do new tRNAs enter?   a) D site b) E site c) A site…

A: DNA => Transcription => mRNA => Translation => Protein. Protein synthesis ( ribosome…

Q: Indicate whether there is matching (1) or base complementarity (2) between the following nucleic…

A: The template strand is also called antisense strand.  Biosynthesis of mRNA using antisense strand of…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.