The following is a part of the sequence on DNA template strand. 5' ATGGCCCGGTAAGTA 3' Write the corresponding mRNA sequence as triplets. Label the 5' end and 3' end. а. Write the three-letter abbreviation of amino acid sequence translated. Label the N-terminus and C-terminus. b. Write the three-letter abbreviation of amino acid sequence translated after the underlined base is mutated to T. Label the N-terminus and C-terminus. с.
Q: Discuss the following statement: “enzymes and heat are alike in that both can speed up reactions…
A: Enzymes are a crucial part of the biological environment. They work only at optimum temperature.…
Q: С 17 Based on the knowledge you gained from the cloning module, which of the bands in the figure is…
A: Agarose gel electrophoresis is a method used in molecular biology to resolve DNA fragments on the…
Q: Answer choices : 0.3% gel OR 1.0% gel Explanation Choices : Agarose makes smaller pore sizes which…
A: agarose gel electrophoresis is widely used to resolve DNA fragments. DNA fragments migrate accorsing…
Q: a) Use the carbonyl group, number of carbons, and type of stereochemistry (D or L) t classify the…
A: Introduction: Stereochemistry is a branch of chemistry that is based on the three-dimensional…
Q: How many ATP or NADH molecules are produced or required in each of the following steps in…
A: Introduction: The pathway is also known as the Embden-Meyerhof pathway and every cell carries the…
Q: SIT C. A saturated soil has he following characteristics: Initial volume = 21 cm³ Final Volume = 13…
A: Saturated soil is the soil in which all the pore spaces get filled with water completely. This soil…
Q: 1. The enzyme that catalyzes the transformation of C2H2 + H2 to C2H4 is likely to be classified as…
A: Enzymes are described as those proteins that have a major contribution to speeding up different…
Q: The metabolic function of the pentose phosphate pathway is to: a. generate NADPH and pentoses for…
A: Pentose phosphate pathway also called the hexose monophosphate shunt is an alternative pathway for…
Q: The succinyl CoA to citrate pathway of the citric acid cycle is shown. Identify the missing…
A: Succinyl Co-A and the reactions given in the question are part of the TCA cycle. The TCA cycle is a…
Q: 8. Which of the following is characteristic of a competitive inhibitor of an enzyme-catalyzed…
A: Enzymes are biological catalysts which play important role catalysis of biochemical reactions.…
Q: Fill in the missing bases below to show the correct complementary base pairing. 5' 3'
A: In molecular biology Complementary base pairing or complementarity is a relation between two…
Q: 3. Give the specific enzyme class and first two digits of the enzyme's EC number for each…
A: Hi! Thank you for the question. We are authorized to answer three subparts at a time, since you have…
Q: Choose any/all that apply to lipids.
A: Lipids are biological macromolecules, insoluble in water/polar solvents but soluble in non-polar…
Q: 1. Where is insulin synthesised and in what form is it stored in the body? 2. Describe the mechanism…
A: Insulin is a peptide hormone composed of 51 amino acids. Insulin is the hormone, which regulates the…
Q: a. Which of the following is FALSE about sucrose? i. It is a non-reducing sugar. ii. It is the…
A: Since there are multiple questions and they are not interlinked, as per our company guidelines only…
Q: Compare and contrast proteoglycans, glycoproteins, and glycosaminoglycans. Cite examples for each
A: Glycobiology means the study of the structure, and function of carbohydrates attached to…
Q: How do ADP and ATP regulate the glycolysis pathway?
A: Glycolysis is an important metabolic pathway which participates in the carbohydrate metabolism. This…
Q: What is the meaning of DFR?
A: DFR is Dihydroflavonol 4-Reductase (DFR), it is expressed by DFR gene.
Q: Elution and regeneration can be carried out in a single step. Explain using relevant examples.
A: In affinity chromatography, elution circumstances can have a direct effect on a quality related…
Q: Long explanations are not needed. Direct answers would suffice. a. Flux through the pentose…
A: The Pentose phosphate pathway is a metabolic pathway that occurs parallel to glycolysis in the…
Q: If a woman that takes folic acid decreasing her risk of neural tube disorder does this mostly change…
A: Folic acid is the synthetic commercial form of vitamin B. it plays crucial role in the formation…
Q: Gluconeogenesis in the liver is activated by O increased circulating levels of glucagon O increased…
A: Gluconeogenesis is the metabolic pathway during which glucose is synthesized from non Carbohydrate…
Q: 2. The following graph illustrate the binding of 02 to proteins: myoglobin and hemoglobin ( one…
A: Hemoglobin is an oligomeric conjugated protein with four peptide chains joined by a…
Q: ATP Accounting Upon digestion of starch, maltose, one of its degradation products, is further…
A: Maltose is formed by the hydrolysis of starch. Maltose is a disaccharide, made up of two glucose…
Q: Phosphoglycerides are composed of: (select all that apply) Group of answer choices sphingosine…
A: Lipids are classified as simple lipids, compound lipids, and derived lipids. Simple lipids are the…
Q: of gene. 12. Steroid hormone receptor complex binds to the A. transcription start site B. promoter…
A: Steroid hormones are lipid-soluble molecules that can easily diffuse through the cell membrane to…
Q: henylalanine pell out the full name of the citric acid cycle Intermediate. If there ls more than one…
A: PKU patients can suffer from intellectual disabilities, brain damage, seizures, and other problems…
Q: ACTIVITY 6.1 Complete the table below Source Example of Carbohydrate Function
A: Carbohydrates are a form of macronutrient that can be found in a variety of foods and drinks.…
Q: a) Give the substrate for each of the following enzymes: (i) urease (ii) fructose oxidase (b)…
A: Introduction: Inhibitors are substances that go and bind to an enzyme and interfere with its…
Q: what are the effects of PSTMB shown and why is it important to show effects of PSTMB in vitro…
A: Introduction: According to the Warburg hypothesis, cancer cells undergo a high rate of intracellular…
Q: An alpha-helical structure within a protein is stabilized mostly by O hydrophobic interactions. O…
A: The primary structure of the protein consists of a linear chain of amino acids linked by the peptide…
Q: 4 Chitin and Amylopectin
A: Most carbohydrates found in nature occur as polysaccharides, polymers of medium to high molecular…
Q: BSA (mg/ml) Absorbancy 540nm 0 0.158 1 0.210 2 0.260 3 0.305 4 0.360 5 0.410 6 0.455 7 0.510 8 0.530…
A: Biuret test is a chemical test used for detecting the presence of peptide bonds, in whose presence…
Q: Which enzyme activity of the glycogen debranching enzyme is operating during the release of glucose…
A: The amylo-1, 6-glucosidase catalytic action of glycogen debranching enzyme permits it to hydrolyze…
Q: Which exemplifies substrate level phosphorylation? O Glucose + ATP --> Glucose-6-phosphate…
A: Substrate-level phosphorylation is a metabolism reaction that aids in the transfer of a phosphate…
Q: The Tm of a DNA strand can be calculated by hand using the formula: (2 ℃)(?????? ?? ? +…
A: Two standard approximation calculations are used. For sequences less than 14 nucleotides the…
Q: In the RBCs of the patient described above, which ONE of the following listed below would be…
A: Pyruvate kinase deficiency is an inherited lack of the enzyme pyruvate kinase, which is used by red…
Q: 6. H₂C HO Which of the following dinucleotides can be methylated by DNA methyltransferase? NH₂ NH₂ 9…
A: Since you have asked multiple questions, we will answer only first question for you. In order to get…
Q: the Km of an enzyme for its substrate tends to be close to the physiological (cellular)…
A: Enzymes are the biological catalyst which to increase the rate of reaction. Km is also called as the…
Q: RESOLVE STRICTLY IN DIGITAL FORMAT, TO BE ABLE TO COPY TO WORD. THANK YOU Different varieties of…
A: The concetration of total alcohols and reducing sugar are two determined to be the important…
Q: Lactic acid fermentation is used to regenerate i. FADH2 ii. ATP iii. NADH iv. NAD'
A: The lactic acid produced in the muscle during lactic acid fermentation is transported to the liver,…
Q: When weighing the protein at the end of the activity, what major assumption is made about the…
A: Casein is a protein present in milk that contributes to the white colour of the milk. Cow's milk…
Q: Discuss how adsorption, covalent binding, entrapment and encapsulation are used to immobilize…
A: Enzymes are biocatalyst that increases the speed of reaction by lowering the activation…
Q: What is the net change in high energy bonds in the reaction below? Predict the standard free energy…
A: The reaction that is depicted is Succinyl coA+ GDP+ Pi ----> succinate+ coAsh + GTP. This is an…
Q: The product formed in the first substrate-level phosphorylation reaction in glycolysis is…
A: 1. Glycolysis is a process in which one mole of glucose is partially oxidised into 2 moles of…
Q: Which of the following cofactors is NOT used by the pyruvate dehydrogenase complex? a. NAD+ b. FAD…
A: The pyruvate formed by the process of glycolysis is converted into acetyl-CoA. The reaction is…
Q: 1. A new drug was developed to inhibit RNA transcription of a new strain of bacteria infected in…
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: ACTIVITY 6.2.6 Give the complete name of the disaccharides below: 1. Lactose 2. Cellobiose
A: Essentially, a disaccharide is made up of two monosaccharides (simple sugars) linked together. A…
Q: what happens to the intactness of DNA if extracted DNA fibers were placed in buffer of pH 3?
A: Extracted DNA is generally stored in neutral pH.
Q: . Which of the following descriptions of EF-Tu is correct? A. EF-Tu delivers fMet- RNA to the A site…
A: Introduction: Elongation factors deliver aminoacyl-tRNA to the ribosome. Ef-Tu is a monomeric…
Step by step
Solved in 2 steps with 1 images
- Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:The template strand of a segment of double-helical DNA contains the sequence – 5’-CTT-AAC-ACC-CCT-GAC-TTC-GCG-CCG-CAT-3’ a. What is the base sequence of the complementary strand of DNA? Indicate the 5’ and the 3’ ends. b. What is the base sequence of the mRNA that can be transcribed from this template DNA strand? Indicate the 5’ and the 3’ ends. c. What amino acid sequence can be coded by the mRNA in (b) starting from the 5’ end (or the N terminal amino acid)?Given the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' where N stands for any nucleotide, give the complementary mRNA sequence. Indicate direction of strand as 3'--> 5' or 5'--> 3' as in the given sequence above. Give the amino acid sequence of your mRNA sequencelin No. 1. Indicate direction of strand as above. Use all lowercase letters, 3-letter name of amino acid separated by a hyphen (-), no spaces in-between.
- Use a codon chart determine the amino acid sequence. Remember to read through the strand and ONLY start after the promoter and STOP when it tells you to stop. Follow example below: Example: DNA AGA TATA TAC CTC CGG TGG GTG CTT GTC TGT ATC CTT CTC AGT ATC MRNA O protein AUG GAG GCC ACC CAC GAA CAG ACA UAG GAA GAG UCA UAG start-glu-ala-thre-hist - asp-glu-threo-stop met DNA CCT ATA TAC ACA CGG AGG GTA CGC TAT TCT ATG ATT ACA CGG TTG CGA TCC ATA ATC mRNA DGGA UAU) AUG uGul Gcc nccl cAul GCol protein ly Tur MeT cys AlA ser HIJ Ala 2 3 4 DNA AGA ACT ATA TAC CTC TTA ACA CTC TAA AGA CCA GCA CTC CGA TGA ACT GGA GCA mRNA protein DNA TAT ATAC CTT GGG GAA TAT ACA CGC TGG CTT CGA TGA ATC CGT ACG GTA CTC GCC ATC mRNA protein D DNA TAA ACT ATA TAC CTA GCT TAG ATC TAA TTA CCC ATC mRNA protein Auu UGA UAU AGU GAUCGA AUC MAG Auu AAU leu Stop. TRY-Met-Asp- ARG-Isle-Stop-Ile. Asn DNA CTA TTT ATA TAC TAG AGC GAA TAG AAA CTT ATC ATC mRNA protein D DNA CAT ATA TAC CTT AGT TAT CCA TTG ACT CGA ATT GTG CGC TTG…For each of the following items, fill in either the DNA strand, the MRNA codons, the tRNA anticodons, or the amino acid sequence that have been left blank. If several sequences might work, choose only one. Furthermore, circle the start and the stop codons of each mRNA sequence. 1. DNA (3'-5') ACG TAC GGC CGG TTA AAG CAT ACT TTC TTG MRNA TRNA Amino Acid 2. DNA (3'-5') MRNA AUG ACU AGC UGG GGG UAU UAC UUU UAG AAA TRNA Amino Acid 3. DNA (3'-5') MRNA TRNA GCU CCU UAC CAC ССС CGU AUG GCU GGG AUC Activate Go to Sett Amino AcidThe DNA sequence below is transcribed from left to right (the partner/coding strand is shown). Using this sequence, write the sequence of the polypeptide that results from this gene. Be sure to appropriately label the ends of the molecule. 5'-ATGCACGGCGACTAG-3' Second letter A UAU Tyr UAC First letter U A G U UUU1 UUC UUA LOU Leu CUU CUC CUA CUG Phe GUU GUC GUA GUG Leu AUU AUC lle AUA AUG Met Val C UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala CAU His CAC CAA CAG Gin AAU Asn AAC AAA 1 Lys AAG LYS G {}a UAA Stop UGA Stop A UAG Stop UGG Trp GAU 1 GAC Asp GAA GIU Glu GAGJ UGU UGC CGU CGC CGA CGG AGU AGC AGA AGG Cys GGU GGC GGA GGG Arg Ser Arg DOA DOA DOA DUTO Third letter Gly
- This is the non-template strand of a double stranded DNA. RNA is transcribed from using one of the strand (which one?) . Show the RNA sequence from 5’ to 3’ direction. Then translate the RNA sequence into protein sequence using the genetic code table. 5’AGGGTCCAC 3’Below is a double stranded DNA that contains an ORF. Identify the ORF and in the spaces below, first provide the mRNA sequence that would result (in the 5' to 3' direction). Then give the protein sequence this mRNA would encode (in the N to C direction using the 3-letter abreviations and a single space in between). 5'-CTGCGC TAGGCGCAGTAGGGCATCCCACGACA-3' 3'-GACGCGATCCGCGTCATCCCG TAGGG TGC TGT-5' Codon Table: บบบ UUC JUA UUG CUU CUC CUA CUG Phe GUU GUC GUA GUG Leu Leu AUU AUC lle AUA AUG Met Val mRNA sequence: UCU UCC UCA UCG protein sequence: CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala UAU UAC UAA UAG CAU CAC CAA CAG Tyr Stop GAU GAC His Gin AAU Asn AAC AAAG} LUS Asp GAA GAG} Glu UGU Cys UGC UGA Stop UGG Trp CGU CGC CGA CGG AGU AGC Arg Ser AGG} Arg GGU GGC GGA GGG (DO NOT include the 5' and 3' numbers or the N and C. Write only the nucleotides and the abreviations for the amino acids. Include no spaces in the mRNA and a single space in between the amino acid…-Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT -Write down the complementary mRNA sequence for each of the following DNA sequence. A: TACCTAGCGCACATGTAGGTGGGCAAAGTT B: TAC ATG GTT ACA GTC TAT TAG ATG CTA TTT ACT TAG -If the first G changes to A what kind of mutation will happen? Show the change in amino acid sequence. This is base substitutions involve the replacement of one nucleotide with another. And it changes one amino acid coding, producing a missense mutation TAC CTA GCA CAC ATGTAGGTGGGCAAAGTT TAC CTA ACACACATGTAGGTGGGCAAAGTT
- Given the following DNA sequence: ATCGGATCCGGTTAACTATTTAAAGCA a. predict the compliment strand of dna (coding strand) b. predict the transcribed product of the coding strand (mRNA transcript) c. given the genetic code table, predict the amino acid sequence of the transcript d. predict the amino acid sequence if the A underlined became deletedGiven is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 5’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 3’ a. What is the complementary strand? b.Deduce the mRNA in this coding region. c.What is the amino acid sequence based on this mRNA? d. A very important mutation in human hemoglobin occurs in this DNA sequence, where the T at nucleotide 20 is replace with an A. The mutant hemoglobin is called sickle cell hemoglobin and is associated with severe anemia. What is the amino acid replacement that results in sickle-cell hemoglobin?Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 5’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 3’a. What is the complementary strand?b. Deduce the mRNA in this coding region.c. What is the amino acid sequence based on this mRNA?d. A very important mutation in human hemoglobin occurs in this DNA sequence, where the T at nucleotide 20 is replace with an A. The mutant hemoglobin is called sickle cell hemoglobin and is associated with severe anemia. What is the amino acid replacement that results in sickle-cell hemoglobin?