The eukaryotic chromosomes are linear DNA molecules with free 3'-OH and 5'-PO3- ends. DNA free ends are signals of double strand breaks, which are highly detrimental for the cell. Using the diagram below as a reference, describe structurally how telomeres resolve this problem. Make sure to highlight the interactions involved, the nature of the telomeric sequences and the correct nomenclature for the structure formed.**Diagram Explanation:**- The diagram illustrates the structure of telomeric DNA at the ends of eukaryotic chromosomes.- **Telomeric DNA (green bar):** It consists of repetitive sequences. The sequence shown is TTGGGG TTGGGGT TGGGG, with the 5' to 3' direction labeled.- **Non-telomeric DNA (gray bar):** It has the complementary sequence of AACCCTAACCCTAACCCCAACCCT, 3' to 5'.**Formation of T-loop:**- The telomere forms a protective loop structure called a T-loop.- The 3' overhang (TTGGGG) invades the double-stranded region, pairing with the complementary strand.- This invasion and looping back creates a displaced single strand, visually forming a loop.**Structural and Functional Significance:**- The T-loop structure protects chromosome ends from being recognized as DNA damage.- The interactions between the telomeric sequences stabilize the loop, preventing unwanted degradation and fusion of chromosomes.- This configuration is essential for maintaining genomic integrity.Understanding this structural adaptation is crucial for insights into chromosome stability and cellular aging processes. The model illustrates the formation of condensates during transcription, highlighting two main types: the Dynamic Promoter Condensate and the Transient Gene-Body Condensate.**Dynamic Promoter Condensate:**- **Enhancer:** A DNA sequence that facilitates the transcription of a particular gene.- **Transcription Factor:** Proteins that bind to specific DNA sequences, controlling the rate of transcription.- **Initiation Factors and Co-activators:** Assist in the assembly of the transcription machinery at the gene promoter.- **Pol II (RNA Polymerase II):** An enzyme involved in transcribing DNA into messenger RNA.- **Promoter:** A region of DNA where transcription of a gene is initiated.The Dynamic Promoter Condensate is formed by the interaction of RNA Polymerase II, transcription factors, initiation factors, and co-activators at the promoter region, facilitated by the enhancer.**Transient Gene-Body Condensate:**- **Elongation and RNA Processing Factors:** These assist in the elongation phase during transcription and the processing of RNA.- **P (Phosphorylation):** Represents the addition of a phosphate group, which is a crucial regulatory mechanism for transcription.This figure shows an active transcription process where the transient gene-body condensate facilitates transcription elongation, aided by elongation and RNA processing factors and marked by phosphorylation.Overall, this model explains how condensates form during transcription to facilitate gene expression and processing, with each type playing a distinct role in the transcription process.

According to our guidelines we are allowed to do one question or up to three sub apart of a…

The eukaryotic chromosomes are linear DNA molecules with free 3'-OH and 5'-PO3- ends. DNA free ends are signals of double strand breaks, which are highly detrimental for the cell. Using the diagram below as a reference, describe structurally how telomeres resolve this problem. Make sure to highlight the interactions involved, the nature of the telomeric sequences and the correct nomenclature for the structure formed. 5' Telomeric DNA TTGGGGTTGGGGTTGGGG 3' TGGGGז AACCCC AACCCCAACCCC AACCCCAACCCC Non-telomeric DNA TTGGGG 3' TGGזGG AACCCC. 5' AACCCC AACCCC TTGGGG TTGGGG TTGGGGTTGGGGTTGGGG AACCCCAACCCCAAC C AACCCC TGGGGז

The eukaryotic chromosomes are linear DNA molecules with free 3'-OH and 5'-PO3- ends. DNA free ends are signals of double strand breaks, which are highly detrimental for the cell. Using the diagram below as a reference, describe structurally how telomeres resolve this problem. Make sure to highlight the interactions involved, the nature of the telomeric sequences and the correct nomenclature for the structure formed. 5' Telomeric DNA TTGGGGTTGGGGTTGGGG 3' TGGGGז AACCCC AACCCCAACCCC AACCCCAACCCC Non-telomeric DNA TTGGGG 3' TGGזGG AACCCC. 5' AACCCC AACCCC TTGGGG TTGGGG TTGGGGTTGGGGTTGGGG AACCCCAACCCCAAC C AACCCC TGGGGז

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

Where do you predict the N- and C-termini are located for Max? Match the words in the left column to the appropriate blanks in the sentences on the right. electrostatic dispersion negative C-terminus positive positively negatively N-terminus The Reset Help is interacting with the DNA. The first reason for this is because the a-amino group is positively charged and will interact favorably with the of the charge on the phosphodiester backbone of the DNA. The second reason is that this orientation also situates the partial end of the helical macrodipole for favorable interactions with the charged phosphodiester backbone of the DNA
Histones contain many basic amino acids including lysine. DNA and histones collectively form chromatin. Open chromatin is much more open and accessible to the transcriptional machinery than closed chromatin. Histone lysine acetylation is associated with open chromatin and occurs near genes that are being actively transcribed. Part A Given what you know about the chemical properties of DNA and the function of histones. whv do histones contain so many basic amino acids? Answer in no more than two sentences. Part B Given what you know about how acetylation affects lysine, why does histone lysine acetylation open chromatin? Answer in one sentence only.
Isein) are shówn in the following document: Codon Number Base Sequence of Normal DNA Transcribed Strand ТАС ТСС СТС AAT СТ AAT TTG Base Sequence of Abnormal DNA Transcribed strand ТАС ТСС СТС AAT CTT ATT TTG 7. Compare the 2 DNA sequences and explain the absence of functional casein in abnormal females.
One of the original structures proposed for DNA had all the phosphate groups positioned at the center of a long fiber. Give a reason why this proposal was rejected
Consider the following DNA strand with the following nucleotide sequence: 3’-ATATCAGAGAATATCA-5’ The nucleotide sequence of the complementary DNA strand is . b. The nucleotide sequence of the antisense strand used in the transcription process is . c. The nucleotide sequence of the mRNA strand produced after the transcription process is 2. Compute for the base composition of a DNA molecule given that %T is 23% (reported to the nearest whole number; no need to add the % symbol). % A? %C? %G?
Place the following eukaryotic DNA structures in order of thickness, smallest to largest heterochromatin double helix nucleosomes 30 nm chromatin fibre looped domain
Forming nucleosomes and wrapping them into a 30-nm fiber provide part of the compaction of DNA in chromatin. If the fiber contains about six nucleosomes per 10 nm of length, what is the approximate compaction ratio achieved?
Given the coding strand DNA sequence below, what change would occur in the expressed protein sequence if a mutation resulted in insertion of C between the final two nucleotides? 5'-AATGCCGTAA-3' Expressed protein would be extended (lengthened) O Correct answer not given No change would occur in the expressed pratein OExpressed protein would be truncated (shortened) OA single amino acid in the expressed protein would be substituted
Give correct detailed Solution with explanation needed...don't give Handwritten answer..don't use Ai for answering this. Don't copy answer anywhere
Within living cells, many different proteins play importantfunctional roles by binding to DNA. Some proteins bind to DNA butnot in a sequence-specific manner. For example, histones are proteinsimportant in the formation of chromosome structure. The positivelycharged histone proteins bind to the negatively charged phosphategroups in DNA. In addition, several other proteins interact with DNAbut do not require a specific nucleotide sequence to carry out theirfunction. For example, DNA polymerase, which catalyzes thesynthesis of new DNA strands, does not bind to DNA in a sequencedependentmanner. By comparison, many other proteins do interactwith nucleic acids in a sequence-dependent fashion. This means that a specific sequence of bases can provide a structure that isrecognized by a particular protein.Someexamples include transcription factors that affect the rate oftranscription and proteins that bind to origins of replication inbacteria.What topic in genetics does this question address?
How are deoxyribonucleoside triphosphates (precursors of daughter DNA strands) and ribonucleoside triphosphates (precursors of RNA strand) differ from each other?
Describe the packaging of chromosomal DNA by histones with diagrammatic representations. Name the various histone modifications and describe any two among them.