Where do you predict the N- and C-termini are located for Max?Match the words in the left column to the appropriate blanks in the sentences on the right.electrostaticdispersionnegativeC-terminuspositivepositivelynegativelyN-terminusTheReset Helpis interacting with the DNA. The first reason for this is because the a-amino groupis positively charged and will interact favorably with theof thechargeon the phosphodiester backbone of the DNA. The second reason is that this orientation also situates thepartialend of the helical macrodipole for favorableinteractions with thecharged phosphodiester backbone of the DNA

Proteins are biomolecules made up of repeating monomeric units known as "amino acids", the sequence…

electrostatic dispersion negative C-terminus positive positively negatively N-terminus is interacting with the DNA. The first reason for this is because the a-amino group charge of the is positively charged and will interact favorably with the on the phosphodiester backbone of the DNA. The second reason is that this orientation also situates the partial end of the helical macrodipole for favorable interactions with the charged phosphodiester backbone of the DNA The

electrostatic dispersion negative C-terminus positive positively negatively N-terminus is interacting with the DNA. The first reason for this is because the a-amino group charge of the is positively charged and will interact favorably with the on the phosphodiester backbone of the DNA. The second reason is that this orientation also situates the partial end of the helical macrodipole for favorable interactions with the charged phosphodiester backbone of the DNA The

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter30: Protein Synthesis

Section: Chapter Questions

Problem 2P

See similar textbooks

Similar questions

On average, how many phosphoanhydride bonds (P;-P; bonds) are directly hydrolyzed in thecourse of synthesizing a 200 amino acid protein? Assume that you begin with the mature mRNA,ribosomal subunits, tRNAs, free amino acids, and all necessary factors.
I. A protein, X, was Isolated from a pathogenlc mlcroorganism. The proteln Is a vlrulence factor whose path0genlclty lies In a heptapeptide of unknown sequence. After trypsin cleavage of the heptapeptide from protein X, the peptlde's compOsition and sequence was determined. The fOllowing were the results of the sequenclng process: 1. When the peptide was treated with dinitrofluorobenzene (DNFB), DNP-asp and a mixture of amino acids were produced. 2. When the same Intact peptide was treated with streptococcal protease, a pentapeptide of composition asp, asN, cys, gly and ser and 2 amlno acids were released. 3. When the heptapeptlde was also treated with hydrOxylamine HCI, a tripeptide and a tetrapeptide were obtained. The C-terminal amino acid of the tripeptide was asN. 1) What is the sequence of the heptapeptide if it is composed of cys, asp, lys, asN, gly and ser only? 2) What is the pl of the heptapeptide?
During translation, the tRNA antlicodon sequence G-A-U vyould blnd to which MRNA codon (plck one of the cholces I -V below)? Note: all of the sequencos for tho quostlon and answors use the standard convention for representing ollgonuclootidos discussed In class whoro tho 5'-ond Is at the loft and the 3'-ond Is at the right. I) G-A-U II) U-A-G I) C-U-A IV) A-U-C V A-T-C OA. none of the cholces OB. IV Oc." OD.! OE, II
Give the translation of the segment of a polypeptide chain below. Specify your template strand. —ссстAс стссттс сттссссА — |||||||||||||||| ||||| -cC GATCGACGAA GGA ACCCC T-
Cytosine deaminationoccurs ~100 cytosinesper genome per day in a human genome. Eukaryotic cells also contain residues of 5’-methylcytosine, which is involved in regulating gene transcription rates. Mutation of 5’-methylcytosine by deaminationconverts it to thymine. This presents the cell with a much more severe problem than normal cytosine deaminationof cytosine to uracil. Why?
Figure 28.41 gives some examples of recombination in IgG codons 95 and 96, as specified by the Vkand Jkgenes. List the codon possibilities and the amino acids encoded if recombination occurred in codon 97. Which of these possibilities is less desirable?
What is the length in AA’s of the LilP protein? Assume fMet is NOT CLEAVED. Write out the sequence of the polypeptide in AA: use the three letter notation, e.g. Met-Ser-Pro-
With this DNA sequenec: - 5'-GCAATGGAGAGAATCTGCGCG-3'- - 3'-CGTTACCTCTGTTAGACGCGC-5' - -Identify the sequencce of RNA in which the protein product will be detrnemined. -What will be the protein product sqeuence? -What will be the pl of the protein product?
One of the amino acid sequences in the lysozyme protein from the bacterial virus T4 studiesby Streisinger and co-worker was .... Lys – ser – pro – ser – leu – asn – ala – ala – lys. Thisparticular amino acid was found to have changed to lys – val – his –his –leu –met –ala –ala–lys... as a result of a single nucleotide deletion and addition approximately 15 bases apartin the mRNA. Which base was deleted and which was added? Give the altered sequence of bases inthe altered amino acid.
One of the amino acid sequences in the lysozyme protein from the bacterial virus T4 studiesby Streisinger and co-worker was .... Lys – ser – pro – ser – leu – asn – ala – ala – lys. Thisparticular amino acid was found to have changed to lys – val – his –his –leu –met –ala –ala–lys... as a result of a single nucleotide deletion and addition approximately 15 bases apartin the mRNA.a. What is the sequence of the nucleotides that produce the original protein.b. Which base was deleted and which was added? Give the altered sequence of bases inthe altered amino acid.
5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3' What oligopeptide is encoded by the above sequence? Please use the one-letter code for your answers. (You will need to consult the Table of the Genetic Code for this question) 1st letter UUU Phe UCU UCC Leu UCA UCG U UUC UUA UUG CUU C CUC CUA CUG AUU A AUC AUA AUG U GUU G GUC GUA GUG CCU Leu CCC CCA CCG ACU lle ACC ACA Met ACG GCU Val GCC GCA GCG с Second Letter Ser Pro Thr Ala UAU UAC A | AAU AAC AAA AAG GAU GAC GAA GAG Tyr CAU CAC CAA Gin CAG 1 UAA Stop UGA Stop A UAG Stop UGG Trp G His Lys UGU UGC Asp Glu G 3rd Asn AGU Ser U letter AGC AGA AGG Cys U CGU CGC Arg CGA CGG GGU GGC GGA GGG DCAG DUAG DUCAG Arg Gly UCAG
What are the functional consequences of this deletion for lilP mRNA transcription and translation? (100 words max.)