Human Anatomy & Physiology (11th Edition)
11th Edition
ISBN: 9780134580999
Author: Elaine N. Marieb, Katja N. Hoehn
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
The estimated half-life for P-O bonds is 1.3 x 105 a (a = annum = year). Approximately 109 such bonds are present in a strand of DNA. How long (in terms of its half life) would a single strand of DNA survive with NO cleavage (in the absence of DNA repair enzymes)?
Ans: 3067 years
Expert Solution
This question has been solved!
Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.
This is a popular solution
Trending nowThis is a popular solution!
Step by stepSolved in 2 steps
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- a) It is known that double stranded DNA is denatured at low pH. pKa values should allow the determination of whether this is due to perturbation of the hydrogen bonding in A-T and/or G-C base pairs. The table gives values for the pKas of different protonated groups in the nucleobases.Nucleobase Position & pKa A N1, 3.5 G N7, 1.6; N1, 9.2 C N3, 4.2 T N3, 9.7a) Draw the A-T and G-C base pairs. - Label the bases with the one-letter code. – - Number the atoms in the rings and label the atom that attaches to the sugar. - Mark the groups that interact in normal…arrow_forwardThe A and G compositions (mole percent) of one of the strands of a duplex DNA is A = 27 and G = 30. (a) What would be the T and C compositions of the complementary strand? (b) What can be said about the A and G compositions of its complementary strand?arrow_forwardDiscuss the following statement: “the DNA repair enzymes that fix deamination and depurination damage must preferentially recognize such damage on newly synthesized DNA strands.”arrow_forward
- The Tm of a DNA strand can be calculated by hand using the formula: (2 ℃)(?????? ?? ? + ?) + (4 ℃)(?????? ?? ? + ?) = ??℃ Using this formular, calculate the Tm for the following DNA sequence: [CTTTCACAGCCACTATCCAGCGGTAC] Note: This formula has several limitations and is not useful for sequences longer than 14 bp. Use the Internet search to find an online Tm calculator. Use this calculator to find the Tm of the above sequence. Using information from your search, identify three factors that can affect the Tm.arrow_forwardThe question is attachedarrow_forwardWhat is the survival value of semiconservative reproduction of DNA? : What is the survival value of semiconservative reproduction of DNA? – Define what semiconservative reproduction is and the explain why this would have survival value.arrow_forward
- It is known that double stranded DNA is denatured at low pH. pKa values should allow the determination of whether this is due to perturbation of the hydrogen bonding in A-T and/or G-C base pairs. The table gives values for the pKas of different protonated groups in the nucleobases.Nucleobase Position & pKa A N1, 3.5 G N7, 1.6; N1, 9.2 C N3, 4.2 T N3, 9.7a) Draw the A-T and G-C base pairs. - Label the bases with the one-letter code. – - Number the atoms in the rings and label the atom that attaches to the sugar. - Mark the groups that interact in normal…arrow_forwardThe figure shows that the average distance between base pairs measured parallel to the axis of a DNA molecule is 3.4 Å. The average molar mass of a pair of nucleotides is 650 g•mol-1. Estimate the length in cm of a DNA molecule of molar mass 5.1x109 4.0 .26 g•mol-1. cm Roughly how many base pairs are contained in this molecule? [4.0 784615 x base pairs CG G C OH TA Thymine Adenine H. H. OH CH2 N-H.......O CH3 H H N……·H–N HLH TA OH 0-P H2C CG G C H. CH2 Guanine H OH Cytosine ... H-N TA AT H' N.....H-N HLH N-H.......O H2C OH H -o. -P3D0 TA 0- OH H. -CH2 (b) The most common structure of DNA, which is a right-handed double helix. The two strands are held together by hydrogen bonds (a) Base-pair formation between adenine (A) and thymine (T) and between cytosine (C) and guanine (G). and other intermolecular forces.arrow_forwardAt 260 nm what component of DNA absorbs at this nm(hydrogen bond, phosphate backbone, nitrogenous base, deoxyribose).arrow_forward
- For the following steps in DNA replication, name the prokaryotic and eukaryotic enzymes (in that order!) that perform the task listed: Question 33 options: Tethering a polymerase to DNA (prokaryotes) Removing supercoils (eukaryotes) Removing supercoils (prokaryotes) Lagging strand replication (eukaryotes) Lagging strand replication (prokaryotes) Tethering a polymerase to DNA (eukaryotes) Stabilizing single-stranded DNA (prokaryotes) Stabilizing single-stranded DNA (eukaryotes) 1. DNA Pol III 2. DNA Pol Delta () 3. DNA Pol Epsilon () 4. Helicase 5. Topoisomerase (type I or II) 6. Beta clamp 7. PCNA 8. SSB 9. RPA 10. DNA Pol I 11. Ligasearrow_forwardThe diagram below is of a short stretch of prokaryotic chromosomal DNA in the process of replication.Please supply the specific pieces of information requested by the boxes below.arrow_forwardAmino acids have an average molar mass of 100 g/mol.How many bases on a single strand of DNA are needed to codefor a protein with a molar mass of 5x10^5g/mol?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education