
Biochemistry
9th Edition
ISBN: 9781319114671
Author: Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.
Publisher: W. H. Freeman
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
The length of a DNA molecule is 680 nm when the DNA molecule is in B-conformation. How many helical turns does the DNA molecule have if the DNA molecule is in A-conformation?
Expert Solution

This question has been solved!
Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.
Step by stepSolved in 3 steps

Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- Draw and label a diagram showing four DNA nucleotides, linked together in two strands. PLEASE DRAW ON PAPERarrow_forwardIf you analyze a double-stranded DNA molecule and find that 15% of all the nucleotide bases are Adenines, you know that there must also be [ Select ] Thymines, [ Select ] Guanines, [ Select ] v Cytosines and [ Select ] Uracils. (Count each of the bases in any double stranded DNA molecule and calculate their percentages to find the simple key for this if you haven't seen it yet.)arrow_forward1). What is the concentration of a solution of DNA with an OD260 of 0.3? ----I got 15 micrograms/mL (50 x 0.3) 2). How many microliters of this solution of DNA would you need if you wanted 1.5 micrograms?arrow_forward
- The figure shows that the average distance between base pairs measured parallel to the axis of a DNA molecule is 3.4 Å. The average molar mass of a pair of nucleotides is 650 g•mol-1. Estimate the length in cm of a DNA molecule of molar mass 5.1x109 g•mol-1. 4.0 cm Roughly how many base pairs are contained in this molecule? 4.0 7.1e6 X base pairs AT CG OH O-P=D0 G C TA Adenine Thymine OH CH2 N-H.......O CH3 H -N N..... G C H A Он C G G C TA AT OH CH2 Cytosine Guanine H. O.......H-N H H' H N…**H-N HLH O N-H..... H2C OH TA OH CH2 (b) The most common structure of DNA, which is a right-handed double helix. The two strands are held together by hydrogen bonds and other intermolecular forces. (a) Base-pair formation between adenine (A) and thymine (T) and between cytosine (C) and guanine (G).arrow_forwardWhat is the name of the enzyme that add nucleotides to a growing DNA strand? What kind of bonds does this enzyme form between the nucleotides?arrow_forwarddraw the structure of the polynucleotide GTarrow_forward
- The A and G compositions (mole percent) of one of the strands of a duplex DNA is A = 27 and G = 30. (a) What would be the T and C compositions of the complementary strand? (b) What can be said about the A and G compositions of its complementary strand?arrow_forwardThe Tm of a DNA strand can be calculated by hand using the formula: (2 ℃)(?????? ?? ? + ?) + (4 ℃)(?????? ?? ? + ?) = ??℃ Using this formular, calculate the Tm for the following DNA sequence: [CTTTCACAGCCACTATCCAGCGGTAC] Note: This formula has several limitations and is not useful for sequences longer than 14 bp. Use the Internet search to find an online Tm calculator. Use this calculator to find the Tm of the above sequence. Using information from your search, identify three factors that can affect the Tm.arrow_forwardHow many times wider is a 30 nm fiber than a DNA double helix? Show your work.arrow_forward
- Using the figure below, what is molecule "A" (type a 1, 2 or 3 in the blank) nuclease ligase DNA polymerase What is the function of molecule "A"? to separate the double helix into two to piece together the Okazaki segments to copy the new DNA strand to the old strand by complementary base pairing Using the figure below, what is molecule "G" (type a 1, 2 or 3 in the blank) nuclease ligase DNA polymerase What is the function of molecule "G"? to separate the double helix into two to piecearrow_forwardShow the replication strands in each of these bubbles (note they have different DNA orientations). Label each end of each DNA strand and include arrows to show which direction it is extending. Show the Okazaki fragments in the correct places. 3' 5'arrow_forwardThe figure shows that the average distance between base pairs measured parallel to the axis of a DNA molecule is 3.4 Å. The average molar mass of a pair of nucleotides is 650 g•mol-1. Estimate the length in cm of a DNA molecule of molar mass 5.1x109 4.0 .26 g•mol-1. cm Roughly how many base pairs are contained in this molecule? [4.0 784615 x base pairs CG G C OH TA Thymine Adenine H. H. OH CH2 N-H.......O CH3 H H N……·H–N HLH TA OH 0-P H2C CG G C H. CH2 Guanine H OH Cytosine ... H-N TA AT H' N.....H-N HLH N-H.......O H2C OH H -o. -P3D0 TA 0- OH H. -CH2 (b) The most common structure of DNA, which is a right-handed double helix. The two strands are held together by hydrogen bonds (a) Base-pair formation between adenine (A) and thymine (T) and between cytosine (C) and guanine (G). and other intermolecular forces.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- BiochemistryBiochemistryISBN:9781319114671Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.Publisher:W. H. FreemanLehninger Principles of BiochemistryBiochemistryISBN:9781464126116Author:David L. Nelson, Michael M. CoxPublisher:W. H. FreemanFundamentals of Biochemistry: Life at the Molecul...BiochemistryISBN:9781118918401Author:Donald Voet, Judith G. Voet, Charlotte W. PrattPublisher:WILEY
- BiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage LearningBiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningFundamentals of General, Organic, and Biological ...BiochemistryISBN:9780134015187Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. PetersonPublisher:PEARSON

Biochemistry
Biochemistry
ISBN:9781319114671
Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.
Publisher:W. H. Freeman

Lehninger Principles of Biochemistry
Biochemistry
ISBN:9781464126116
Author:David L. Nelson, Michael M. Cox
Publisher:W. H. Freeman

Fundamentals of Biochemistry: Life at the Molecul...
Biochemistry
ISBN:9781118918401
Author:Donald Voet, Judith G. Voet, Charlotte W. Pratt
Publisher:WILEY

Biochemistry
Biochemistry
ISBN:9781305961135
Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher:Cengage Learning

Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning

Fundamentals of General, Organic, and Biological ...
Biochemistry
ISBN:9780134015187
Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson
Publisher:PEARSON