The length of a DNA molecule is 680 nm when the DNA molecule is in B-conformation. How many helical turns does the DNA molecule have if the DNA molecule is in A-conformation?

The figure shows that the average distance between base pairs measured parallel to the axis of a DNA molecule is 3.4 Å. The average molar mass of a pair of nucleotides is 650 g•mol-1. Estimate the length in cm of a DNA molecule of molar mass 5.1x109 g•mol-1. 4.0 cm Roughly how many base pairs are contained in this molecule? 4.0 7.1e6 X base pairs AT CG OH O-P=D0 G C TA Adenine Thymine OH CH2 N-H.......O CH3 H -N N..... G C H A Он C G G C TA AT OH CH2 Cytosine Guanine H. O.......H-N H H' H N…**H-N HLH O N-H..... H2C OH TA OH CH2 (b) The most common structure of DNA, which is a right-handed double helix. The two strands are held together by hydrogen bonds and other intermolecular forces. (a) Base-pair formation between adenine (A) and thymine (T) and between cytosine (C) and guanine (G).

What is the name of the enzyme that add nucleotides to a growing DNA strand? What kind of bonds does this enzyme form between the nucleotides?

draw the structure of the polynucleotide GT

The A and G compositions (mole percent) of one of the strands of a duplex DNA is A = 27 and G = 30. (a) What would be the T and C compositions of the complementary strand? (b) What can be said about the A and G compositions of its complementary strand?

The Tm of a DNA strand can be calculated by hand using the formula:           (2 ℃)(?????? ?? ? + ?) + (4 ℃)(?????? ?? ? + ?) = ??℃   Using this formular, calculate the Tm for the following DNA sequence:                       [CTTTCACAGCCACTATCCAGCGGTAC]   Note: This formula has several limitations and is not useful for sequences longer than 14 bp. Use the Internet search to find an online Tm calculator. Use this calculator to find the Tm of the above sequence. Using information from your search, identify three factors that can affect the Tm.

How many times wider is a 30 nm fiber than a DNA double helix? Show your work.

Using the figure below, what is molecule "A" (type a 1, 2 or 3 in the blank) nuclease ligase DNA polymerase What is the function of molecule "A"? to separate the double helix into two to piece together the Okazaki segments to copy the new DNA strand to the old strand by complementary base pairing Using the figure below, what is molecule "G" (type a 1, 2 or 3 in the blank) nuclease ligase DNA polymerase What is the function of molecule "G"? to separate the double helix into two to piece

Show the replication strands in each of these bubbles (note they have different DNA orientations). Label each end of each DNA strand and include arrows to show which direction it is extending. Show the Okazaki fragments in the correct places. 3' 5'

The figure shows that the average distance between base pairs measured parallel to the axis of a DNA molecule is 3.4 Å. The average molar mass of a pair of nucleotides is 650 g•mol-1. Estimate the length in cm of a DNA molecule of molar mass 5.1x109 4.0 .26 g•mol-1. cm Roughly how many base pairs are contained in this molecule? [4.0 784615 x base pairs CG G C OH TA Thymine Adenine H. H. OH CH2 N-H.......O CH3 H H N……·H–N HLH TA OH 0-P H2C CG G C H. CH2 Guanine H OH Cytosine ... H-N TA AT H' N.....H-N HLH N-H.......O H2C OH H -o. -P3D0 TA 0- OH H. -CH2 (b) The most common structure of DNA, which is a right-handed double helix. The two strands are held together by hydrogen bonds (a) Base-pair formation between adenine (A) and thymine (T) and between cytosine (C) and guanine (G). and other intermolecular forces.